Блог сергея тарасова: Модульное оригами Блог Сергея Тарасова – Модульное оригами для начинающих и профессионалов: схемы, мастер-классы, видеоуроки!

Разное

Содержание

Галерея работ

НАЖМИТЕ НА ЛЮБУЮ КАРТИНКУ И ОТКРОЕТСЯ МАСТЕР-КЛАСС

Схема вазы оригами


Яйцо оригами


Заяц оригами


Зайка оригами


Оригами храм


Лебедь триколор

 

Лебедь в черном


Лебедь в красном


Подсолнухи

 

Лебедь в голубом


Ваза


Мой первый лебедь


Танк

 

Корзинка

 

Радужный лебедь

 

Ёлочка

 

 

Колокольчик


Лебедь в розовом

 

 

 

Барашек Шон

 

Барашек

 

 

Баран

 

Пингвин оригами


Ананас

 

Шляпа


Сборка вазы оригами


Яйцо (подставка)


Яйцо мастер-класс

 

Пасхальное яйцо схема

 

Яйцо схема сборки

 

Яйцо схема


Пасхальное яйцо


Пасхальный кулич


Подарок на 23 февраля


Валентинка из бумаги


Сердце


Как сделать Валентинку


Валентинка


Валентинка


Павлин


Павлин оригами схема


Схема сборки павлина


Дед Мороз


Снеговик оригами


Снегурочк


Корзинка оригами


Корзинка


Елка оригами


Ваза двусторонняя


Клубника оригами


Клубника из бумаги


Ваза оригами


Ваза схема сборки


Ваза мастер-класс


Самовар из оригами


Чайник из оригами


Самолет


Кружка и блюдце


Схема вазы


Оригами ваза схема


Модульное оригами ваза


Ваза оригами


Оригами сборка вазы


Оригами ваза


Ваза из модулей


Радужный лебедь


Оригами лебедь


Схема сборки лебедя


Схема лебедя оригами


Лебедь триколор


Схема лебедя


Мистер Крабс


Губка Боб


Матрешка


Изготовление модуля


Схема стрекозы


Самолет


Рамка для фото


Схема рака


Кружка

origamimodule.ru… Модульное оригами Блог Сергея Тарасова – Модульное оригами д…. Реформал.

Рейтинг:

Адрес:

http://origamimodule.ru

Безопасность данных:

Степень доверия:

Безопасность для детей:

Не определена

О сайте:

Анализ данных origamimodule.ru показал, что у этого домена низкий рейтинг Alexa и это малоизвестный сайт с плохой посещаемостью (не более 10 тыс. в месяц). Лидирующую позицию по доле трафика занимает Россия (64,8%), а владельцем домена является Private Person.

Заголовок:

Модульное оригами Блог Сергея Тарасова – Модульное оригами для начинающих и профессионалов: схемы, мастер-классы, видеоуроки!

Мета-описание:

Модульное оригами для начинающих и профессионалов: схемы, мастер-классы, видеоуроки!. Здравствуйте уважаемые мастера и мастерицы, с вами Сергей Тарасов, и мы продолжа…

Рейтинг Alexa

1 641 341

Посетителей в день

251

Просмотров в день

502

Статус:

Онлайн

Дата последней проверки:

Big Blog PhDrDAK: февраля 2015

Теперь, в воскресенье смогу его поздравить.

Вот поэтому я и стал пользователем «русского биатлона»!

[Правка 15 февраля 2015]


Поздравляю Сергея Петровича Тарасова с юбилеем!

Желаю успехов его биатлонной школе!

Самому Сергею Тарасову здровья и счастья.

Спасибо юбиляру за его замечательные победы в биатлоне,

особенно за победу в индивидуальной гонке 20 км 
на Олимпийских играх в Лиллехаммере в 1994 году.

Вот и подарок олимпийскому чемпиону 

и нам — всем северянам, любящим зиму, морозец, снег, скрип лыж: 

 Яркая победа Сергея Тарасова на экранах Вашего компа,

полная трансляция мужской гонки на 20 км олимпиады 1994 года —




Бонус — 
Интервью с нынешним олимпийским чемпионом Сергеем Тарасовым
о школе его биатлона
Змеиногорский Вестник —


[Окончание правки 15 февраля 2015]

Опубликовано в моем http://phdrdak.livejournal.com/18303.html 12 февраля 2015



Вспомнил нашего олимпийского чемпиона, понятно, после напоминания нашими сми жуткой кровавой истории, когда Сергей Тарасов чуть не помер.

В голове не укладывается: 

Сергей Петрович Тарасов 

не только оправился, но и выиграл Олимпиаду!

«

КРОВЬ

– История, как за Олимпиаду-1992 вы едва не заплатили жизнью, окутана тайной.

– Это произошло с 6 на 7 февраля. Второй мой день рождения. На мне ставили эксперимент.

– С кровяным допингом?

– Да. Смысл в чем? Кровь берут летом, на пике формы. Обогащают витаминами, закладывают в холодильник, хранят до зимних стартов. Затем достают, доводят до комнатной температуры и вливают.

Биатлонисты никогда этими делами не занимались. А тут решили попробовать. Первый и последний раз. В Минске взяли у четверых. Но в Альбервилль нашу кровь везли несколько суток. И не в холодильнике, а в обычном дипломате.

– Это критично?

– Она испортилась! После рассказывал докторам – у них глаза на лоб: «Не обманывай». – «Так и было». – «Да за это расстреливают!»

– Мы слышали, вам просто ввели другую группу крови.

– Тоже нельзя исключать. Бирок на колбе не было. Я это заметил, спрашиваю врача сборной: как же так? Отвечает: «Два человека – с четвертой группой, два – с первой. Всех помню».

– Врач – Алексей Кузнецов.

– Совершенно верно. Он-то должен был понимать, во что превратилась кровь! Предупредить тренеров, что вливать нельзя ни в коем случае. Те – не специалисты.

Я был в списке первым. Пообедали, говорят: «Заходи». Обратил внимание – доктора трясет. Я даже произнес: «Спокойнее! Что волнуетесь-то?» Может, он уже что-то плохое подозревал?

Минут десять вливал – никаких ощущений. Льет и льет. Пульс у меня в первый тренировочный день ударов 35 в минуту. И вдруг за секунду взлетает до двухсот! Я чувствую, как сердце разрывает! Руки-ноги вверх подбрасывает. Он сразу лить прекратил, но уже пошло отторжение, криз.

– Потеряли сознание?

– Оно то уходило, то возвращалось. Сквозь пелену видел, что доктор пытается сделать укол, никак шприцем не попадет… Начали в обед, а на «скорой» отправили в местную клинику, когда стемнело. Меня несут, у дверей лыжник Вовка Смирнов – на этом воспоминания обрываются.

– Была клиническая смерть?

– Да. Я уверен, что кому-то спас жизнь.

– Почему?

– Другой умер бы. Сами врачи говорили – случай из разряда «невыживаемых». Когда выкарабкался, французские врачи всей клиникой ходили на меня смотреть. Четверо суток мониторы показывали – пульс 160 ударов в минуту. Какое сердце выдержит?! Мне повезло, что с гор спустились невероятно натренированные.

Сейчас рассказываю – и мне страшно. Вся кровь заражена, нужно было выкачивать. Вместо нее вливали гемодез. На его основании костный мозг начинал вырабатывать кровь – чтоб организм по новой запустился. У меня выпали волосы, ногти, с рук и ног лохмотьями слезала кожа… Умирающие говорят про какой-то тоннель, да?

– Был тоннель?

– Нет. Был свет. Очень яркий. Думаю, в тот момент я был на грани – туда или сюда. Внезапно услышал голос дочери: «Папа! Папа!» После этих слов умереть не мог. Они вернули к жизни. Дороже Кати у меня нет никого.

– Где в это время находилась дочь?

– В Новосибирске с мамой. Когда очнулся, предложили, чтоб жена прилетела в Альбервилль. Ответил – не надо. Зачем ее пугать? Я потерял более десяти килограммов. От ветра шатало. День на пятый вывели под руки на прогулку, вдохнул воздух – так сиделка меня еле удержала.

– Доктор Кузнецов навещал?

– Конечно. И тренеры приходили, и ребята. Как-то заглянули Толя Жданович с Женей Редькиным. Толя бодрился, старался отвлечь. А Женька поздоровался – и больше не выдавил ни звука. Потом рассказал: «Ты был в таком состоянии, что меня от ужаса парализовало. Лишился дара речи…»

– Кузнецов извинялся?

– Не было извинений. И обид у меня поначалу не было, позже дошло что к чему. Сейчас-то его простил, отношения нормальные. Никто убивать меня не желал. Сам виноват, что на эксперимент согласился.

– Правда, что кого-то из сборников эта беда в Альбервилле тоже коснулась – но с менее тяжелыми последствиями?

– Нет-нет, на мне тогда остановились. Знаю, что-то похожее сотворили в свое время с нашим конькобежцем – он умер. Да и про меня по телевидению объявили, что скончался. Слава богу, ни жена, ни мама не слышали. Через полчаса дали опровержение – извините, пока живой.




Турнир по домино памяти Сергея Тарасова станет ежегодным

Около 40 сильнейших игроков из  России и стран СНГ соберутся 10 октября в Петербурге на международный турнир по домино, посвященный памяти Сергея Тарасова.

Уже подтвердили участие в турнире сильнейшие «доминошники» — многократные чемпионы Санкт-Петербурга, участники чемпионатов мира братья Александр и Владимир Корнеевы, Марк Бриль и другие. Московские мастера хотят приехать сильнейшим составом, собираются «не ударить лицом в грязь» и сборные других регионов.

Как сообщили в пресс-службе городской администрации, мемориал Тарасова Федерация домино планирует сделать традиционным. Все партии здесь будут играться по международным правилам. Одна из их особенностей заключается в том, что игроки не имеют права брать «кости» домино в руки, они должны располагаться на столе, перед глазами играющих.

Отметим, что экс-председатель Законодательного собрания Санкт-Петербурга, бывший вице-губернатор города и член Совета Федерации, председатель правления госкомпании «Российские автомобильные дороги» Сергей Тарасов, чья жизнь трагически оборвалась 27 ноября 2009 года во время крушения скорого поезда 166 «Невский экспресс», был поклонником домино и прекрасно владел секретами этой народной игры. Уровень подготовки Тарасова позволил ему выступать даже на чемпионате мира в Санкт-Петербурге в мае прошлого года.

Напомним, что домино родом из древнего Китая, время происхождения — приблизительно 1120 г. н.э. Первоначально эта игра называлась «Костяные таблички». Интересно, что на китайских табличках, кстати, как и на костях, не было нулевого очка («мыло»). Оно появилось в Европе, куда домино завез венецианец Марко Поло. Вначале этой игрой увлекались монахи, затем из Италии она перекочевала во Францию, в конце XVIII веке появилась в Англии. Название «домино» произошло от сочетания белого и черного цветов. Вообще-то, «домино» — французское слово. Так называли священники-христиане зимнее одеяние, которое было черным снаружи и белым внутри. «Домино» — это также тип маски, представляющей черный и белый мотив. В Корее и Индии домино до сих пор служит инструментом для предсказания судьбы. Так что первоначально эти костяшки предназначались исключительно для гадания и магических церемоний. На Востоке известно 47 различных игр с использованием домино. Существуют домино с цветными костяшками, где цвет обозначает достоинство. Названия игр чрезвычайно поэтичны: «гвоздики в тумане», «войти в погоду», «прыжок газели».

▶▷▶▷ оригами двойной лебедь из треугольных модулей подробная схема

▶▷▶▷ оригами двойной лебедь из треугольных модулей подробная схема
ИнтерфейсРусский/Английский
Тип лицензияFree
Кол-во просмотров257
Кол-во загрузок132 раз
Обновление:18-03-2019

оригами двойной лебедь из треугольных модулей подробная схема — Yahoo Search Results Yahoo Web Search Sign in Mail Go to Mail» data-nosubject=»[No Subject]» data-timestamp=’short’ Help Account Info Yahoo Home Settings Home News Mail Finance Tumblr Weather Sports Messenger Settings Want more to discover? Make Yahoo Your Home Page See breaking news more every time you open your browser Add it now No Thanks Yahoo Search query Web Images Video News Local Answers Shopping Recipes Sports Finance Dictionary More Anytime Past day Past week Past month Anytime Get beautiful photos on every new browser window Download Модульное оригами лебедь из треугольных модулей — схема сборки 7gyru/detskoe-tvorchestvo/origami/147-origami Cached Модульное оригами лебедь из треугольных модулей — схема сборки Танграм своими руками (схемы игры, фигуры) Поделки на 8 марта дома и в детском саду Бумажный лебедь из модулей — infoniacru wwwinfoniacru/news/Lebed-iz-moduleihtml Cached Лебедь оригами из треугольных модулей Схема Этап iii 13 В третьем компоненте вам нужно использовать 12 модулей и построить 6 одинаковых ряда Модульное оригами: Лебедь схема сборки planetaorigamiru/2011/05/modulnoe-origami-lebed-sxema Cached Модульное оригами : Лебедь схема сборки треугольных модулей , которые предстоит собрать Танк из модулей оригами схема — Оригамир origamirru/bez-rubriki/tank-iz-modulej-origami-sxemahtml Cached Танк из модулей оригами схема из треугольных модулей оригами готов! оригами двойной Модульное оригами жар птица схема сборки — Оригамир origamirru/bez-rubriki/modulnoe-origami-zhar-ptica Cached Модульное оригами жар птица состоит из 1989 треугольных модулей : 1330 — бардовых, 394 — голубых, 228 — белоснежных, 20 — зелёных, 17 — жёлтых1 Оригами лебедь из модулей — webdianaru webdianaru › … › Рукоделие Оригами — лебедь из модулей : пошаговая инструкция по изготовлению двойного лебедя Каждый, кто знаком с искусством оригами , наверняка хотел бы изготовить фигурку лебедя Схемы оригами из бумаги: лебедь, машина и роза | Nisataru nisataru › Оригами Сова из модулей 47 852 0 Модульное оригами / Крылья, лапы и хвосты Сова из модулей благодаря красивым очкам выглядит очень умной Модульное оригами сова состоит из 433 белых треугольных модулей оригами из модулей собака схема — ruclotuti1973’s diary ruclotuti1973hatenablogcom/entry/2017/06/12/052003 Cached Оригами лебедь двойной из треугольных модулей — схема и мастер класс Как сделать собаку из бумаги своими руками Собака собака оригами Смотреть все схемы по запросу: Собаки Дед мороз из треугольных модулей 7gyru/detskoe-tvorchestvo/origami/70-ded-moroz Cached Модульное оригами лебедь из треугольных модулей — схема сборки Танграм своими руками (схемы игры, фигуры) Поделки на 8 марта дома и в детском саду Волк оригами и схемы в подробном фото-видео мастер-классе podelki-xru › Оригами Журавлик оригами : схема подробная для начинающих, отзывы двойной лебедь из модулей Promotional Results For You Free Download | Mozilla Firefox ® Web Browser wwwmozillaorg Download Firefox — the faster, smarter, easier way to browse the web and all of Yahoo 1 2 3 4 5 Next 148 results Settings Help Suggestions Privacy (Updated) Terms (Updated) Advertise About ads About this page Powered by Bing™

  • Мастер-класс Поделка изделие Оригами китайское модульное Радужный лебедь Бумага. Я никогда не занима
  • лась этим, но быстро освоила технику и уже через 5 дней у меня был готов двойной лебедь. Огромнейшее спасибо за подробнейший урок! Лебедь, модульное оригами. Схема сборки треугольного модуля. Оригами
  • спасибо за подробнейший урок! Лебедь, модульное оригами. Схема сборки треугольного модуля. Оригами схемы. Дочка очень любит конструировать из бумаги и мне было сложно найти доступную ее пониманию подборку, а здесь собраны доступные пониманию и очень интересные схемы. В технике оригами существует такое весьма популярное течение, как «Модульное Оригами». Отличительной особенностью этого течения является то, что объекты создаются с использованием огромного. Каталог товаров Интернет-магазина My-shop.ru: Оригами. Цены, аннотации. Представляем вашему вниманию невероятно подробный иллюстрированный самоучитель по самой популярной бумажной технике – модульному оригами. Отзывы покупателей на товар «Объемное оригами 8 quot;Лебедьquot; (956008)» За полезные отзывы в Жили-были дают бонусы подробнее. Оригами Шар из цветов АБ 41-501 Клевер. Приклеиваем клюв – оранжевый треугольный модуль. «Лебедь» в технике оригами. МК для начинающих «Рыбки». ← Предыдущий топик | следующий топик →. Модульное оригами Modular Origami | Крылатый лебедь | 181 модуль. Это может быть все, что угодно — животные, цветы и т.д. Крылатый лебедь — одно из красивейших созданий в объемном оригами — анатомически правильная форма лебедя отражает природную красоту этой птицы. Метки: оригами , модульное… Изготовление лебедя (модульное оригами) Методическая разработка урока: «Обработка боковых и нижнего срезов детали нижней части фартука двойной косой обтачкой». Модульное оригами — это искусство складывания фигур из бумаги. Владивостокский университет экономики и сервиса. Сведения о кафедрах, факультетах, изучаемых специальностях. Международные программ, расписание занятий. Аннотация фгос3 компьютерные технологии в проектировании среды модуль 4. Папка apos;оригами apos; — Елена Георгиевна Янкевич. Модульный объемный дракон оригами из треугольных модулей, видео ч 1. Fenka 1.5 BeadsWicker — Программа для построения схем для бисера.

модульное оригами. Схема сборки треугольного модуля. Оригами схемы. Дочка очень любит конструировать из бумаги и мне было сложно найти доступную ее пониманию подборку

модульное оригами. Схема сборки треугольного модуля. Оригами схемы. Дочка очень любит конструировать из бумаги и мне было сложно найти доступную ее пониманию подборку

  • 394 — голубых
  • лапы и хвосты Сова из модулей благодаря красивым очкам выглядит очень умной Модульное оригами сова состоит из 433 белых треугольных модулей оригами из модулей собака схема — ruclotuti1973’s diary ruclotuti1973hatenablogcom/entry/2017/06/12/052003 Cached Оригами лебедь двойной из треугольных модулей — схема и мастер класс Как сделать собаку из бумаги своими руками Собака собака оригами Смотреть все схемы по запросу: Собаки Дед мороз из треугольных модулей 7gyru/detskoe-tvorchestvo/origami/70-ded-moroz Cached Модульное оригами лебедь из треугольных модулей — схема сборки Танграм своими руками (схемы игры
  • 228 — белоснежных

оригами двойной лебедь из треугольных модулей подробная схема — Поиск в Google Специальные ссылки Перейти к основному контенту Справка по использованию специальных возможностей Оставить отзыв о специальных возможностях Нажмите здесь , если переадресация не будет выполнена в течение нескольких секунд Войти Удалить Пожаловаться на неприемлемые подсказки Режимы поиска Все Картинки Видео Новости Карты Ещё Покупки Книги Авиабилеты Финансы Настройки Настройки поиска Языки (Languages) Включить Безопасный поиск Расширенный поиск Ваши данные в Поиске История Поиск в справке Инструменты Результатов: примерно 15 (0,51 сек) Looking for results in English? Change to English Оставить русский Изменить язык Результаты поиска Картинки по запросу оригами двойной лебедь из треугольных модулей подробная схема Другие картинки по запросу «оригами двойной лебедь из треугольных модулей подробная схема» Жалоба отправлена Пожаловаться на картинки Благодарим за замечания Пожаловаться на другую картинку Пожаловаться на содержание картинки Отмена Пожаловаться Все результаты Мастер-класс двойного лебедя | Страна Мастеров Сохраненная копия 1 февр 2010 г — Мастер-класс Поделка изделие Оригами китайское модульное Мастер-класс двойного лебедя Бумага Для сборки лебедя нам нужно сделать такую кучу модулей Вас не затруднит,подскажите как вы их собрали,давно ищу схему именно таких лебедей Треугольный модуль оригами Не найдено: подробная Модульное оригами – схема сборки двойного лебедя Сохраненная копия Похожие 28 апр 2012 г — Модульное оригами – Двойной лебедь Чтобы получить классический треугольный модуль , необходимо разрезать лист А4 на 32 Не найдено: подробная Двойной лебедь оригами своими руками wwwcomfortclubru › Главная › Библиотека › Разное › Сделай сам Сохраненная копия Похожие Рейтинг: 3,5 — ‎10 голосов 14 июл 2015 г — Существует много схем и вариантов исполнения различных животных, растений и других Двойной лебедь оригами своими руками Для того, чтобы сделать классический треугольный модуль , нужно разрезать Не найдено: подробная Модульное оригами Лебедь Мастер класс — YouTube — Pinterest Модульное Оригами , 3d Оригами , Bliss, Лего, Вазы, Руководства, Бумажные Конверты modular origami swan Свадьбы В Стиле Оригами , Киригами, Схема создания модульного оригами лебедя из бумаги для svoimi-rukami-clubru/создаем-модульное-оригами-лебедя/ Сохраненная копия Похожие 26 дек 2014 г — Наша подробная схема с фото и описанием поможет с легкостью создавать объёмные фигуры из треугольных модулей оригами Оригами вазы сборка — Модульное оригами Блог Сергея Тарасова origamimoduleru/sborka-vazy-origamihtml Сохраненная копия 28 апр 2014 г — Продолжить сборку ваз оригами , а именно двухцветных Ваза из модулей оригами схема (продолжение) Великолепные лебеди Оригами двойной лебедь подробная схема из треугольных docplayerru/71888405-Origami-dvoynoy-lebed-podrobnaya-shema-iz-treugolnyh-mo СкачатьОригами двойной лебедь подробная схема из треугольных модулей на комп схемы , чертежи, карты, pdf прямыми линиями, которые проводят Корзинка из модулей оригами — Оригамир origamirru/bez-rubriki/korzinka-iz-modulej-origamihtml Сохраненная копия В третьей части мастер-класса я Вам предлагаю два видеоурока и подробную схему оригами как сделать лебедя Седьмой ряд: модули надеваем по Карандашница модульное оригами схема сборки origami-modulru/21-karandashnica-modulnoe-origamihtml Сохраненная копия Похожие 7 мар 2014 г — Для сборки модульного оригами «карандашница» нам потребуется 504 треугольных модуля (336 синих и 168 оранжевых модулей ) Метки / двойной лебедь схема оригами модульное — Viewy viewyru/search/двойной%20лебедь%20схема%20оригами%20модульное Сохраненная копия Оригами лебедь двойной из треугольных модулей — схема и мастер класс двойной , СВАДЕБНЫЕ ЛЕБЕДИ — модульное оригами , подробная схема Лебедь оригами в пошаговых фото-видео мастер-классах › Оригами Сохраненная копия Учимся собирать белого лебедя в классическом оригами из листа бумаги и объёмного 3D схеме элементов, в рукоделии из бумаги они называются модули свои силы впервые приводим подробную инструкцию по их созданию: Чтобы лебедь из треугольных модулей получился таким, как на картинке Модульные оригами схемы лебедя — » предложим вам форму studio-lanaru/?rst=modulnie-origami-shemi-lebedya Сохраненная копия 23 февр 2018 г — Оригами лебедь двойной из треугольных модулей — мастер класс Это одна из более обычных схем лебедя из картонных Я приготовил для вас два видеоурока и подробную схему оригами лебедя из модулей Оригами двойной лебедь из треугольных модулей подробная схема lenspru/?kdm=origami-dvoynoy-lebed-iz-treugolnih-moduleyshema Сохраненная копия Тифозные из телефона и коды для лепки Установки из телефона и коридорной для лепки Ведущих из обзора и касательные для панды Лебедя Модульное оригами лебедь из треугольных модулей схема сборки medpetspbru//modulnoe-origami-lebed-iz-treugolnyh-moduley-shema-sborki-versiya Рейтинг: 63% — ‎20 отзывов Оригами лебедь из бумаги — модульное оригами блог сергея Довольно не МЕДПЕТСПБ / NEW / Модульное оригами лебедь из треугольных модулей схема сборки Модульное оригами лебедь двойной данное усовершенствованная Предлагаем вам подробную видео инструкцию по сборке модульного Модульные оригами объемный белый лебедь схема сборки medpetspbru/next/modulnye-origami-obyemnyy-belyy-lebed-shema-sborki Сохраненная копия Рейтинг: 77% — ‎23 отзыва Схема создания модульного оригами лебедя из бумаги Объемные Лебедь двойной , свадебные лебеди — модульное, подробная , двойной лебедь — Модульное оригами , оригами из треугольных модулей , фигурки из бумаги, Пояснения к фильтрации результатов Мы скрыли некоторые результаты, которые очень похожи на уже представленные выше (20) Показать скрытые результаты Вместе с оригами двойной лебедь из треугольных модулей подробная схема часто ищут самый большой лебедь из модулей модульное оригами лебедь с сердцем модульное оригами лебедь с ажурным хвостом кусудама лебедь бумажный лебедь как сделать модульное оригами здания схемы как быстро сделать модули для оригами огромный лебедь из модулей Ссылки в нижнем колонтитуле Россия — Подробнее… Справка Отправить отзыв Конфиденциальность Условия Аккаунт Поиск Карты YouTube Play Новости Почта Контакты Диск Календарь Google+ Переводчик Фото Ещё Покупки Документы Blogger Hangouts Google Keep Jamboard Подборки Другие сервисы Google

Мастер-класс Поделка изделие Оригами китайское модульное Радужный лебедь Бумага. Я никогда не занималась этим, но быстро освоила технику и уже через 5 дней у меня был готов двойной лебедь. Огромнейшее спасибо за подробнейший урок! Лебедь, модульное оригами. Схема сборки треугольного модуля. Оригами схемы. Дочка очень любит конструировать из бумаги и мне было сложно найти доступную ее пониманию подборку, а здесь собраны доступные пониманию и очень интересные схемы. В технике оригами существует такое весьма популярное течение, как «Модульное Оригами». Отличительной особенностью этого течения является то, что объекты создаются с использованием огромного. Каталог товаров Интернет-магазина My-shop.ru: Оригами. Цены, аннотации. Представляем вашему вниманию невероятно подробный иллюстрированный самоучитель по самой популярной бумажной технике – модульному оригами. Отзывы покупателей на товар «Объемное оригами 8 quot;Лебедьquot; (956008)» За полезные отзывы в Жили-были дают бонусы подробнее. Оригами Шар из цветов АБ 41-501 Клевер. Приклеиваем клюв – оранжевый треугольный модуль. «Лебедь» в технике оригами. МК для начинающих «Рыбки». ← Предыдущий топик | следующий топик →. Модульное оригами Modular Origami | Крылатый лебедь | 181 модуль. Это может быть все, что угодно — животные, цветы и т.д. Крылатый лебедь — одно из красивейших созданий в объемном оригами — анатомически правильная форма лебедя отражает природную красоту этой птицы. Метки: оригами , модульное… Изготовление лебедя (модульное оригами) Методическая разработка урока: «Обработка боковых и нижнего срезов детали нижней части фартука двойной косой обтачкой». Модульное оригами — это искусство складывания фигур из бумаги. Владивостокский университет экономики и сервиса. Сведения о кафедрах, факультетах, изучаемых специальностях. Международные программ, расписание занятий. Аннотация фгос3 компьютерные технологии в проектировании среды модуль 4. Папка apos;оригами apos; — Елена Георгиевна Янкевич. Модульный объемный дракон оригами из треугольных модулей, видео ч 1. Fenka 1.5 BeadsWicker — Программа для построения схем для бисера.

ALUMNI-MGIMO / PUBLIC BLOG / Врачам говорят: «Шейте маски сами!»

Как оптимизированное здравоохранение Подмосковья встречает эпидемию.
ОТ РЕДАКЦИИ

Татьяна Юрасова, журналист из подмосковных Мытищ, в последние годы опубликовала в «Новой газете» серию ярких расследований о фальсификациях на выборах: по законам нашей страны их фигуранты должны были оказаться за решеткой, но отделались увольнениями и переводом на новые места работы. В «мирное время» между выборами Юрасова — руководитель сайта медицинской журналистики «Здравком». Когда Подмосковье вместе со столицей начало закрываться на полноценный карантин, Юрасова вместо избирательных участков отправилась на станцию скорой помощи и в местную больницу, чтобы своими глазами убедиться в том, что там происходит, и послушать, о чем говорят врачи.

— Куда будут госпитализировать заболевших? — переспросил знакомый врач, когда я озадачила его самым горячим вопросом из мытищинского «Яндекс Района»: повезут ли в Коммунарку или в Мытищинскую горбольницу. К тому времени в Мытищах официально подтвердили один случай коронавируса, и люди волновались. — Вы лучше спросите, на чем их будут возить и какими силами — нет ни машин, ни персонала!

По словам Сергея Тарасова (имя изменено), проработавшего в различных медучреждениях Мытищ более 30 лет, на линию ежедневно выходят не более 13‒15 скорых. За исключением одной педиатрической, все бригады общего профиля. Специализированные бригады, например реанимационные, упразднили за ненадобностью.

По установленным Минздравом РФ нормативам на каждые 10 тысяч населения полагается одна общепрофильная бригада скорой помощи, на 100 тысяч — одна специализированная. Это значит, что в городском округе Мытищи, где только официально зарегистрировано около 250 тысяч жителей, на линии должны работать не менее 25 общепрофильных бригад и, по крайней мере, две специализированные.

В городских пабликах регулярно жаловались на задержку скорых, но было неясно, правило это или исключение. От основной части города Леонидовку — район, где находится Мытищинская подстанция скорой помощи, отделяет узкая эстакада Олимпийского проспекта с вечной пробкой. По сути,

это делает невыполнимым требование доезда до пациента в течение 20 минут с момента вызова, как предписывает приказ Минздрава РФ № 388н от 2013 года.

Не вина скорой, что строительство дорожных сетей в округе сильно отстает от темпов многоквартирной застройки, увеличивающей население и его личный автопарк.

Тем не менее я решаю проверить информацию доктора Тарасова и понять, насколько здравоохранение Мытищ готово к распространению коронавируса.

У меня получилось — помог бывший сотрудник скорой помощи Константин Семенов (имя изменено). В тот день в Мытищах и окрестностях оказывали помощь всего 10 бригад. Только у одной из них была специальная экипировка для работы с инфицированными COVID-19.


Мытищинская станция скорой помощи на Google-картах

Медики без масок

Во двор станции мытищинской скорой помощи на улице Коминтерна въезжает обычная машина с красным крестом, рядом с водителем сидит некто в белом комбинезоне. У водителя рядом маски нет.

— Эта машина только по инфекциям ездит. Видите, специальный костюм, — сообщил сотрудник станции. — Они не так часто выезжают, как остальные, — успокоил он.

В течение часа приезжают еще несколько скорых — никакой спецзащиты, все сотрудники в обычной форменной одежде синего цвета. Они заходят в здание станции и минут через 15 опять уезжают на вызов.

Время от времени сотрудники скорой выходят покурить на крыльцо с дальнего торца здания.

— Один сумасшедший звонит постоянно, мол, у всех нас здесь коронавирус. Мы ему говорим: «Вызывайте врача на дом!» А он: «Вы что, с ума сошли? Мы умираем!»

— А у меня уже к 12 дня от вопросов о коронавирусе бровь начинает дергаться!

Медики ругают «экспертов», которые выступают в ТВ-шоу, запугивая людей. «Блин, коронавирус это не что-то новое, что открыли только сейчас. Новый штамм? Да они постоянно мутируют! Если всем жителям Москвы сделать тест, то у каждого второго обнаружат коронавирус!» — убежденно говорит Юлия (имя изменено).

Люди так боятся коронавируса, что звонят в скорую по любому поводу: температура 37 — они вызывают, подтверждает заведующая Мытищинской подстанции скорой помощи Инна Верхолат. По ее словам, сейчас в сутки поступает на 100 вызовов больше обычного. «Если в субботу (28 марта) было 217 вызовов, то в воскресенье уже 344 — столько вызовов не бывало даже на Новый год», — говорит она.

Иногда граждан вводит в заблуждение и информация, распространяемая органами здравоохранения. Кто-то из фельдшеров рассказывает, как женщина, у родственника которой подтвердили коронавирус, вызвала скорую и ждала несколько часов, когда к ней приедут и возьмут мазки. Рассказ вызывает у медиков взрыв хохота.

— Но ведь женщина поступила по инструкции, — недоумеваю я. Как и другим жителям Подмосковья, мне приходит рассылка областного минздрава с рекомендациями в связи с эпидемией. В одной из них рекомендовался именно такой алгоритм действий в случае общения с инфицированным человеком. Самоизолироваться, позвонить по телефону горячей линии и вызвать врача на дом. «Медицинский работник возьмет анализы для проведения лабораторных исследований», — утверждалось в рассылке.

— Ну да, а мы ее обломали, — смеется фельдшер.

— Вы мазки не берете? — доходит до меня.

Все смеются, но в их смехе мне слышится отчаяние.


Персонал подстанции участвует во всемирном флешмобе медицинских работников. Фото: @ambulancemytishchi

На самом деле скорая помощь не берет никакие мазки, так как для этого у нее нет оснащения: ни специальных палочек, ни реактивов, ни «эппендорфов» — пробирок из специального пластика с защелкивающейся крышкой для защиты образцов от загрязнения. Впрочем, многих обычных медикаментов тоже нет.

По словам Инны Верхолат, у каждой бригады имеются костюмы эпидзащиты «Садолит»: шапочка, очки, маска, халат, фартук. Но лично я не видела, а медики о них не упоминали. Один из них сказал, что одноразовые защитные комбинезоны, респираторы, маски, очки выдали только «инфекционной» бригаде. Как я потом выясню, это обычная общепрофильная бригада, работающая по вызовам тех, кто приехал из-за границы, контактировал с заболевшими коронавирусом, летел определенным рейсом, — на сайте областного минздрава регулярно обновляют список бортов, где выявлены заболевшие. Из Рима, Вероны, Гренобля, Цюриха, Неаполя, Милана, Питера, Мюнхена — около 80 рейсов начиная с 20 февраля. На вызовы обычных пациентов «инфекционная» не ездит, только к контингенту с неблагоприятным эпиданамнезом. Задача бригады — забрать такого больного и отвезти в стационар.

— Куда отвозите, — задаю волнующий местную общественность вопрос.

— К нам, в «инфекцию», в бокс. Еще третий терапевтический корпус под коронавирус отдали. «К нам» — это в Мытищинскую городскую клиническую больницу (МГКБ).

Люди без машин

Покурив, медики уходят. Я иду за угол и сразу натыкаюсь на битую машину «Службы спасения 112» с раскуроченной глазницей на месте правой фары. За ней на приколе стоит еще одна, и еще, и еще. Всего 10‒11 автомобилей в разной степени сохранности.

Все они числятся на балансе мытищинской станции, но ремонтировать их вряд ли будут — нет денег. Служба скорой помощи работает в системе ОМС: бригада выполняет комплекс положенных манипуляций, и страховая компания оплачивает работу по прейскуранту. Коммерческие услуги скорая не оказывает, а значит, не зарабатывает — поэтому денег на обслуживание и ремонт своего автопарка у нее нет. Поэтому запчасти снимают с других машин.


На заднем дворе Мытищинской станции скорой помощи. Фото: Татьяна Юрасова / для «Новой»

На первом этаже станции на стене висит огромная карта Мытищ — полоса городских кварталов, зажатых между ярославским направлением железной дороги и Осташковским шоссе. Однако Мытищинская подстанция скорой обслуживает не только город, но и населенные пункты в сельской местности вплоть до Дмитровского шоссе. Две машины вдоль Дмитровки, еще 10 машин скорой, как мне сказали, в тот день ездили на вызовы непосредственно по городу и окрестностям. Итого — 12 бригад.

— На округ надо не меньше 25 скорых, а у нас в два раза меньше, хотя числится 21 машина. По словам сотрудника, задержки давно стали самым обычным делом.

Конкретно в тот момент уже более четырех часов «висели» 27 вызовов, то есть 27 человек — с острой болью в животе или инфарктом — ждали приезда скорой. Накануне таких вызовов было 40, то есть примерно каждый пятый вызов осуществлялся с задержкой в несколько часов.

— Среднее время ожидания скорой — это три часа, на самом деле часто бывает шесть-восемь часов, — поделился он наблюдением.

— Шесть-восемь часов, — подтвердили еще два человека.

Мытищинская реальность оказалась страшно далека от прекрасных нормативов в 20 минут, указанных на сайте Московской областной станции скорой медицинской помощи.

— Вон, видите, машины стоят? — сотрудник станции обращает мое внимание на две машины в углу двора. — На них некому ездить — врачей нет!

В результате «оптимизации» здравоохранения зарплата врачей в мытищинской скорой упала на 20‒25%, люди стали уходить на работу в Москву, где платили в полтора-два раза больше. Теперь на скорой работают в основном фельдшерские бригады. «Врачей катастрофически не хватает. Укомплектованность врачами, включая совместителей, — 50%, не более; фельдшерские ставки закрыты на 80%», — подтверждает Инна Верхолат. По ее словам, такая ситуация характерна для всего Подмосковья.

В разделе вакансий на сайте Областной скорой врачи и фельдшеры требуются во все муниципалитеты.

Больница без эпидрежима

— Почему вы все жалуетесь, но открыто высказаться боитесь? — не выдерживаю я, когда очередной врач, на этот раз МГКБ, соглашается говорить только на условиях анонимности. В общей сложности я общалась с десятью сотрудниками местных медучреждений и почти все они просили не называть своего имени.

— Потому что критика начальства фактически означает запрет на профессию, — отвечает доктор Дмитрий Назаров (имя изменено). По его словам, недавно за критическое выступление в интернете уволили одного врача скорой. «Классный реаниматолог, молодой и очень перспективный, но его просто загнобили», — говорит Назаров.

Он ведет меня по территории больницы, которая по-прежнему остается единственным стационаром в системе минздрава, оказывающим специализированную медпомощь: «Вот инфекционное отделение для взрослых — здесь есть боксы, а вот третий терапевтический корпус — его отдали под коронавирус».

Обычное больничное здание в три этажа, второй этаж, где раньше находилась офтальмология, зарезервировали под инфицированных COVID-19.


Мытищинская городская клиническая больница. Фото: мгкб.рф

— Сколько там аппаратов искусственной вентиляции легких (ИВЛ)?

— Аппараты ИВЛ не здесь (через несколько дней их доставят в импровизированное инфекционное отделение. — Т.Ю.). Их закупали для нужд реанимации. Поэтому они находятся в приемном покое хирургического отделения и в реанимации.

Заходим в отделение реанимации. Слева в глубине видна палата: на койках без движения лежат обнаженные люди — это общий зал, один из двух существующих. Расстояние между койками менее двух метров: палата рассчитана на 11 человек, а лежат 14 пациентов. Нет ни боксов, ни ширм, изолирующих одну койку от другой.

Справа по коридору комната врачей. В ней спиной к нам, низко склонившись за столом, сидит человек в белом халате и что-то пишет.

— Ну как, готовы к коронавирусу? — говорит вместо приветствия Назаров.

— О чем ты говоришь?

Ничего нет: перчаток не хватает, шапочек не хватает, маски не дают, — отвечает врач. У него хорошее, доброе лицо.

ПРОДОЛЖЕНИЕ

Читать полностью

Отчет о деятельности Botan Investments за октябрь + интервью тренера команд ИКТиИБ ЮФУ Сергея Тарасова

В октябре одно из наиболее значимых событий — четвертьфинал ACM. Виктор Шабуров уже не первый год является спонсором четвертьфинала Южного подрегиона в Саратове. Botan Investments поздравляет всех участников, занявших призовые места, и прошедших в полуфинал! В Южном подрегионе среди вузов-участников грантовой программы фонда в полуфинал вышли: СГУ (Саратов), Самарский Университет (Самара), ВолгГТУ (Волгоград), УлГТУ (Ульяновск), ЮФУ (Ростов-на-Дону и Таганрог), КФУ (Казань), МГУ (Саранск), в Северном подрегионе — САФУ (Архангельск), в Восточном — ПГНИУ (Пермь), УрФУ (Екатеринбург), УГАТУ (Уфа), в Центральном — ЯрГУ (Ярославль), в Западно-Сибирском (ТПУ, СИбГУТИ).

В этом месяце в нашей программе 17 активных университетов, а по количеству активных участников и проведенных тренировок лидируют Уральский федеральный университет (тренер Михаил droptable Рубинчик) и Саратовский государственный университет (тренер Михаил MikeMirzayanov Мирзаянов). А еще в октябре к нам присоединился новый вуз — Ярославский государственный университет.

В группе Botan Investments в ВК продолжают выходить посты Михаила Рубинчика: про основные сборы по подготовке к ACM, алгоритмы, которые должны знать студенты, организацию массовых тренировок любителей.

В этом месяце мы попросили одного из преподавателей, участвующих в нашей грантовой программе, ответить на несколько вопросов. Сергей Seryi Тарасов — тренер команд ИКТиИБ ЮФУ (Таганрог). На четвертьфинале в Саратове его ребята заняли 10 место и прошли в полуфинал, что является очень хорошим показателем для города с населением 250 тыс.

— Сергей, расскажите в общем, насколько развито олимпиадное программирование в Таганроге? Насколько я знаю, был перерыв в несколько лет, и команду пришлось набирать с нуля.

Студенческие олимпиады в Таганроге начали проводить ещё в 90-е годы. В начале 2000-х была разработана своя система тестирования и появилась ежегодная Открытая олимпиада ЮФУ (ТРТУ), которая и по сей день является крупнейшим онсайт-контестом на юге России. За исключением нескольких лет доминирования Ставропольского ГУ с легендарным kia в составе, Таганрогские команды всегда были сильнейшими на юге, а олимпиадное движение — самым активным. Этим можно было гордиться, однако результаты ACM ICPC наглядно демонстрировали, какая пропасть разделяет нас и команды Поволжья, Урала, Сибири, не говоря уже о столицах. Только в 2007-м году нам впервые удалось выйти в полуфинал, и это было огромным шагом вперёд. Если раньше факультатив был развивающим кружком, расчитанным на массы, то теперь мы были одержимы идеей «выйти в финал»: сотнями решали задачи из архивов, тренировались несколько раз в неделю, ездили на сборы и т.д.

Одержимость сыграла с нами злую шутку — пока мы вкладывались в 2 лучшие команды, безуспешно пытаясь пробиться в «элиту», были полностью заброшены остальные. Факультатив стал «закрытым» клубом, попав в который, студенты в ужасе убегали через 2-3 занятия, потому что вместо постепенного развития под руководством тренера им предлагали сразу окунуться в мясорубку спорта высоких достижений. Нашего первого запала хватило на 8 лет регулярных выходов в полуфинал с россыпью дипломов третьей степени. После того как последний из опытных участников закончил обучение, в институте не осталось ни одного студента, имеющего хотя бы малейшее представление об олимпиадах, — только выжженная земля.

К сентябрю 2015-го я уже 3 года не тренировал и не участвовал в контестах, но когда мне предложили вернуться, выбор был очевидным — либо я начинаю всё заново, либо все многолетние усилия пойдут прахом, а олимпиадное движение в Таганроге просто исчезнет или вернётся в каменный век.

Команда ИКТиИБ ЮФУ (Таганрог): Иван Маныч, Эдуард Минасян, Анна Митина

— Как удалось собрать команду, замотивировать ребят начать заниматься?

Таганрог хоть и маленький, но очень IT-шный город. Компаний, занимающихся разработкой ПО, здесь больше, чем во многих городах-миллионниках. Благодаря такому сильному IT-комьюнити, у студентов есть множество возможностей для саморазвития: бесплатные курсы в IT-компаниях, стажировки, хакатоны, CTF (где Таганрог весьма успешен), да и учёбу ведь никто не отменял. Убедить студентов заняться именно олимпиадами сложно — это тяжёлый труд, который не сулит быстрого успеха или лёгких денег. Здесь важен личный пример — я рассказал ребятам о том, что это дало мне: как я проделал путь от учащегося колледжа, делающего «поделки» на Delphi, до полуфинала чемпионата мира, сколько получил уникальных знаний и опыта, и как много хороших людей встретил на этом пути. Конечно, говорил и о профессиональной карьере — своей и знакомых олимпиадников из других городов — у всех она складывается успешно, во многом, благодаря олимпиадному опыту.

В прошлом году я преподавал ООП у второго курса, что позволило мне ближе познакомиться с ребятами и обеспечило приток людей на факультатив. Всего в занятиях участвовало около 20-ти студентов — почти треть профильных студентов второго курса и несколько первокурсников. С точки зрения олимпиад какие-то перспективы были примерно у половины, для остальных же я постарался сделать факультатив приятным местом, где в условиях живого общения с тренером они могут постичь азы C++ и научиться писать эффективный код. Часть способных студентов бросили занятия, увлёкшись чем-то другим или потеряв интерес, — это нормально, ведь спорт подходит не всем. Осенью удалось собрать 2 команды из ребят, готовых тренироваться «на результат», и мы сосредоточились только на подготовке к четвертьфиналу.

— Как готовились к четвертьфиналу?

В течение года занятия не были интенсивными — всего 3-4 часа личных тренировок (мэшапы уровня Div2) в неделю и периодические лекции по теории. Однако благодаря этому постоянству ребята всё время были в тонусе и, что самое главное, решали задачи дома — хотя и меньше, чем мне бы хотелось. Летом удалось отправить одну команду на сборы в Сазанку — там ребята впервые узнали, что тренироваться можно каждый день и это не смертельно. В сентябре, помимо тренировок в институте, две наших команды участвовали в недельных сборах под руководством тренеров из ИТМО, проводимых Botan Investment в Ростове-на-Дону — удалось закрыть несколько пробелов в знаниях и обозначить наши слабые места. Ну а в конце я устроил ребятам марафон из десятка пятичасовых тренировок-четвертьфиналов, лично присутствуя на каждой из них и корректируя их действия. Дьявол кроется в мелочах и важно было научить их самым разным соревновательным аспектам: как угадывать трудоёмкость по ограничениям, какую информацию можно извлечь из монитора, сколько тратить времени на тесты, как параллелить работу за ПК, как выбираться из трудных ситуаций и когда стоит просто дать переписать задачу соседу. И это не говоря уже об обычных разборах задач и корректировке стиля кодирования.

За 2 недели до четвертьфинала ребята из первой команды впервые показали достаточный результат для выхода в полуфинал на тренировке — это нас сильно воодушевило. А на последней тренировке ребята из второй команды неожиданно для всех обыграли первую и тоже виртуально «вышли в полуфинал». Так что учитывая большую квоту региона в этом году, теплилась надежда даже выйти в полуфинал двумя командами. Однако в Саратове у второй команды всё сразу пошло наперекосяк и недостаток опыта не позволил им исправить ситуацию. Зато первая команда преподнесла приятный сюрприз, быстро решив 5 задач без штрафов и войдя в Top 10. Учитывая, что в рейтинге Сodeforces на момент четвертьфинала в команде не было даже ни одного синего участника — это великолепный результат, который показывает значимость командной работы и правильность нашей стратегии тренировок.

Ребята на четвертьфинале Южного подрегиона в Саратове

— Можете дать какие-то советы для преподавателей из небольших городов — как искать студентов, как в течение года подготовить команду к выходу в полуфинал?

Поднять олимпиадное движение в маленьком городе очень трудно. Набор студентов в ВУЗе маленький, а абитуриенты, как правило, не только не имеют опыта участия в олимпиадах, но и вообще не умеют программировать. За всю многолетнюю историю к нам не поступил ни один школьник, имеющий хотя бы какой-то диплом Всероссийской олимпиады по информатике. Так что выбирать студентов не приходится — мы рады всем, кто приходит, а если студент ещё и способный — это большая удача. С другой стороны, как показала практика, подготовить команду уровня середняка полуфинала можно за 1-2 года — нужно заинтересовать студентов, вселить в них уверенность в достижимости успеха, а дальше — решать, решать, решать, в том числе и самому, чтобы не терять связь с реальностью и подавать пример. Если же тренер сам не участвовал в контестах — всё гораздо сложнее, потому что сейчас почти не осталось типовых задач на применение готовых алгоритмов, а навыки, приносящие результат, становятся очень специфичными.

Гораздо больше меня волнует вопрос — как добиться большего и стоит ли оно того? Этого я пока не знаю, потому что тренировка олимпиадника, не имеющего школьных достижений и ЛКШ за плечами, похожа на гонку со временем — на первом курсе учимся программировать, на втором — готовимся к четвертьфиналу, на третьем пытаемся закрепить результат, а дальше… половина ребят разбегается по местным IT-компаниям, а олимпиады уходят на второй план. И даже те, кому удаётся сохранить сильный состав на протяжении пяти лет, имеют мало шансов прорваться в «элиту» и выйти в финал, потому что наша страна — мировой лидер спортивного программирования с сумасшедшей конкуренцией.

Конечно, круто научиться решать «гробовые» задачи, но стоит ли тратить все годы обучения в ВУЗе на то, чтобы научиться их решать за 5 часов, а не за неделю — большой вопрос, ведь дальнейшая профессиональная карьера — это не соревнование на скорость. Ответ скорее всего очень индивидуален: для азартных и увлечённых — конечно, стоит — чтобы не жалеть потом об упущенных возможностях. Для тех же, кто рассматривает олимпиады как способ саморазвития и не ставит больших спортивных целей — не факт. В любом случае, стоит решать задачи до тех пор, пока это доставляет удовольствие, поэтому главная задача тренера — создать здоровую соревновательную атмосферу на тренировках, чтобы студентам хотелось туда возвращаться.

1 | Сергей Тарасов | Фликр

новое сообщение icnflickr-free-ic3d pan white
  • Проводить исследования
    • Последние фото
    • В тренде
    • События
    • Общины
    • Flickr Галереи
    • Карта мира
    • Поиск камеры
    • Блог Flickr
  • Отпечатки
    • Принты и настенное искусство
    • Фотокниги
  • Получить Pro
    • Авторизоваться
    • Зарегистрироваться
    • Авторизоваться
    • Проводить исследования
    • В тренде
    • События
    • Община
    • Галереи Flickr
    • Блог Flickr
    • Принты и настенное искусство
    • Фотокниги
    • Получить Pro
    О Работа Блог Разработчики Методические рекомендации Помощь Справочный форум Конфиденциальность Условия Печенье английский ← → Назад к фотопотоку Сергей Тарасов Автор: Сергей Тарасов.

    Сделанный

    34 Просмотры

    1 любимый

    1 комментарий

    Снято 25 мая 2008 г.

    Все права защищены
    • О
    • Вакансии
    • Блог
    • Разработчики
    • Рекомендации
    • Конфиденциальность
    • Термины
    • Справка
    • Сообщить о нарушении
    • Справочный форум
    • английский
    • SmugMug+Flickr.
    • Конфиденциальность
    • Термины
    • Печенье
    SmugMug+Flickr. Объединение людей через фотографию.
    • О
    • Вакансии
    • Блог
    • Разработчики
    • Рекомендации
    • Сообщить о нарушении
    • Конфиденциальность
    • Термины
    • Справочный форум
    • английский
    • Конфиденциальность
    • Термины
    • Печенье
    • Справка
    SmugMug+Flickr.Объединение людей через фотографию.

    10 больших идей | Блог MCB

    NSF объявляет об информационном вебинаре, обновленных сроках и новых возможностях финансирования для использования революции данных (HDR). HDR является одной из «10 больших идей» и представляет собой деятельность национального масштаба, направленную на создание новых способов открытия на основе данных, которые позволят задавать фундаментальные вопросы и отвечать на них на переднем крае науки и техники.Видение HDR реализуется посредством взаимосвязанного набора мероприятий и возможностей финансирования, каждое из которых предназначено для усиления междисциплинарного характера новой области науки о данных.

    Вебинар HDR

    На вебинаре будет представлен обзор новых заявок и других текущих возможностей финансирования HDR.

              Мероприятие: информационный веб-семинар «Использование революции данных» (HDR)

              Дата: 15 февраля 2019 г. – с 13:00 до 15:00 по восточному времени

              Зарегистрируйтесь заранее здесь

    Обновленные сроки подачи

    В связи с недавним 35-дневным перерывом в ассигнованиях и закрытием агентства NSF продлевает сроки подачи следующих двух запросов HDR.

    NSF 19-518 Революция в области данных (HDR): Data Science Corps (DSC)                

    • Полные предложения должны быть представлены до 14 февраля 2019 г.

    NSF 19-543 Использование революции данных (HDR): Институты исследований в области науки и техники с интенсивным использованием данных – Лаборатории идей (I-DIRSE-IL)

    • Предварительные предложения (обязательно) должны быть представлены до 4 марта 2019 г.
    • Полные предложения должны быть представлены до 19 июня 2019 г.

    Новые возможности финансирования

    NSF 19-550 Использование революции данных (HDR): междисциплинарное исследование принципов науки о данных, фаза I

    • Письмо о намерениях со сроком действия до 25 марта 2019 г.
    • Полное окно предложения 24 апреля 2019 г. – 8 мая 2019 г. Каркасы (I-DIRSE-FW)

      • Полные предложения до 7 мая 2019 г.

      Нравится:

      Нравится Загрузка…

      На горячем сиденье: Дивизия Тарасова в 2019-2020

      Весной этого года Игорь Никитин со своей чемпионской командой ЦСКА и обладателем Кубка Гагарина. (Источник изображения)

      На втором этапе нашего обзора тренеров скамейки запасных КХЛ сезона 2019-20 по дивизионам! Я упомянул во вчерашнем посте о дивизии Чернышёва, что сегодня мы будем рассматривать дивизию Боброва. Тем не менее, на этой неделе есть некоторые новости о тренерском фронте московского «Динамо»; до тех пор, пока это не произойдет, мы представим дивизион Боброва, а вместо этого сегодня мы свяжемся с другой группой в Западной конференции, дивизией Тарасова.Итак, читайте дальше, чтобы узнать о тренировочных ситуациях в московском ЦСКА, минском «Динамо», ярославском «Локомотиве», ХК «Сочи» и «Витязе» (Московская область).

      ЦСКА Москва — Игорь Никитин. Он, наконец, прервал 30-летнюю засуху старой команды Красной Армии в чемпионате, выиграв Кубок Гагарина, и в придачу выиграл чемпионский титул КХЛ; недаром 46-летний Никитин был признан тренером года КХЛ сезона 2018-19. Конечно, массивный состав ЦСКА не помешал, но клуб был «на бумаге хорош» под руководством других тренеров, не завоевав Кубок Гагарина, так что Никитин, которого время от времени критиковали за чрезмерную зависимость от игры в обороне, определенно заслуживает некоторого доверия.Свой третий сезон он начнет в ЦСКА с 2014 года, а также является ассистентом сборной России. Не слишком удивляйтесь, если в будущем году он увидит его главным тренером сборной России; А тем временем Никитин и ЦСКА, похоже, готовы защищать свой долгожданный чемпионский титул. Состав Никитина: Дмитрий Юшкевич (старший), Евгений Корешков (ассистент), Равиль Якубов (ассистент), Сергей Наумов (вратари), Дмитрий Пирожков (силовая и физическая подготовка).

      Крейг Вудкрофт, старший из тренерских братьев Вудкрофт (Тодд Вудкрофт — ассистент в «Виннипег Джетс», а Джей Вудкрофт — главный тренер «Бейкерсфилд Кондорс» АХЛ). (Источник изображения)

      Динамо Минск — Крейг Вудкрофт. Этой весной «Динамо» не торопилось с поиском замены Андрею Сидоренко, который сам был нанят в ноябре вместо Горди Дуайера. Белорусская команда, видимо, была близка к соглашению с Александром Андриевским, но оно сорвалось, и буквально несколько дней назад стало официально известно, что 49-летний Вудкрофт возвращается.Возвращается? Да, это будет второй срок пребывания Вудкрофта в Минске, а в свой первый, в сезоне 2016-17, он привел команду к замечательному восьмому месту в КХЛ. С тех пор «Динамо» не возвращалось в плей-офф, а сезон 2018–19 был особенно мрачным, поскольку они финишировали со счетом 17–45, опередив только «Слован» в общем зачете. Так что Вудкрофту предстоит большая работа, особенно с тем, что на данный момент выглядит довольно скудным составом, но его предыдущий успех в Беларуси вселяет по крайней мере проблески надежды. Посох Вудкрофта: Все еще определяется, но бывший игрок НХЛ Михаил Грабовский утвержден в качестве помощника.

      Локомотив Ярославль — Крейг МакТавиш. 60-летний МакТавиш, великолепный игрок «Локомотива», приезжает в Россию, проработав большую часть последних 20 лет в качестве тренера и исполнительного директора в «Эдмонтон Ойлерз». В некотором смысле это рискованный шаг, поскольку МакТавиш — новичок в КХЛ и нигде не занимал пост главного тренера с 2011–2012 годов. Тем не менее, «Локомотив» — очень солидная организация, которая в прошлом добилась успеха с североамериканскими тренерами (болельщики КХЛ помнят их выход в финал конференции в 2013–2014 годах под руководством Дэйва Кинга).И хотя у Мактавиша неоднозначная репутация среди болельщиков «Ойлерз», он умный парень, проделавший хорошую работу в прошлом. Чтобы помочь ему адаптироваться на новой работе, «Локомотив» привлек опытного в КХЛ канадского помощника главного тренера Майка Пелино, ранее работавшего в магнитогорском «Металлурге» и омском «Авангарде». Их цель будет заключаться в том, чтобы вывести «Локомотив» из того, чем они являются сейчас — очень хорошей командой, но не способной постоянно работать с такими игроками, как СКА и ЦСКА, — в высшую элиту Западной конференции. Персонал Мактавиша: Майк Пелино (ассистент), Яакко Валкама (вратари).

      ХК Сочи — Сергей Зубов. 48-летний Зубов, бывший защитник-суперзвезда НХЛ и один из первых российских игроков, выигравших Кубок Стэнли, вступает в свой третий сезон во главе черноморского клуба, и его первые два должны закончиться как квалифицированный успех. ХК «Сочи» выходил в плей-офф в оба года под руководством Зубова — неплохо для клуба, известного не только своими финансовыми проблемами, но и всем остальным.И хотя им еще предстоит увидеть второй послесезонный раунд, они впервые довели свою серию первого раунда 2018-19 до шести игр. Пусть скромный успех, но тем не менее успех, и Зубов начинает строить из себя что-то вроде тренерского резюме; До того, как возглавить «Сочи», он возглавил СКА после провального пребывания там Андрея Назарова и преуспел в решении вопросов. Штаб Зубова: Павел Гинек (ассистент), Яри Каарела (вратари), Леонид Дмитриченко (силовая и физическая подготовка).

      Торпедо Нижний Новгород — Давид Немировский. Было немного шоком, когда прошлым летом после пятилетнего пребывания Петериса Скудры «Торпедо» выбрало Немировского, у которого вообще не было тренерского опыта. Но Немировский справился; хотя во второй половине сезона 2018/19 «Торпедо» сильно ухудшилось в форме, это было связано как с травмами, так и с чем-то еще, и место в плей-офф было обеспечено на шестой сезон подряд. 42-летний Немировский проводит второй сезон на скамейке запасных, что вполне справедливо, и его основная задача (помимо седьмого сезона подряд для команды) будет заключаться в том, чтобы набраться опыта и усовершенствовать свои тренерские способности.Примечательно: в сезоне 2019/20 «Торпедо» вернулось в Западную конференцию после единственного сезона на Востоке (переезд связан с уходом «Слована» из КХЛ). Состав Немировского: Сандис Озолиньш (старший), Артем Чубаров (ассистент), Клемен Мохорич (вратари), Брент Линкер (силовая и физическая подготовка).

      Витязь Московская область — Михаил Кравец. Иногда это жестокое дело. Все, что сделал Валерий Белов, — дважды за три сезона вывел «Витязь» в плей-офф, это были их первые два матча в КХЛ после окончания сезона.Но, несмотря на этот успех и заявление Белова о желании вернуться, руководство клуба считало, что он зашел так далеко, как только мог, и что этого было недостаточно. Итак, приходит 55-летний Кравец; совсем недавно он закончил прошлый сезон в качестве тренера лучшего фарм-клуба СКА Санкт-Петербург, СКА-Нева, который выиграл титул чемпиона регулярного сезона ВХЛ в сезоне 2019/20. Ему немного не хватает игр главного тренера в самой КХЛ, он провел всего пару недель во главе СКА в сезоне 2012/13, но несколько раз был помощником в лиге и хорошо руководил второстепенными командами. -лиги и юношеские программы, а также.В целом это составляет около 20 лет тренерского опыта, что поможет ему справиться с кривой обучения в КХЛ, но пока мы можем оценить это только как рискованный шаг для маленькой команды из Подольска. Что касается Белова, то думаю, что скоро мы снова увидим его за скамейке запасных КХЛ. Штаб Кравца: Игорь Ефимов (ассистент), Андрей Сапожников (ассистент), Андрей Малков (вратари), Симо Вехвиляйнен (вратари), Алексей Селивёрстов (силовая и физическая подготовка).

      ***

      Спасибо за прочтение! Следующим в этой серии (вероятно) будет Дивизия Харламова, но прежде чем это произойдет, мы взглянем на недавно выпущенный документальный фильм Русская пятерка .Ищите этот пост во вторник или среду на этой неделе, если все пойдет хорошо!

      Нравится:

      Нравится Загрузка…

      Родственные

      Наш блог — HB Auto & AC

      Автомобильные кражи и ваш автомобиль или приложение для социальных сетей, не увидев новостей о другой угнанной машине. И если машину не угнали, мы часто слышим о несчастных, у которых вынули каталитический нейтрализатор.Кражи каталитических нейтрализаторов быстро увеличились за последний год, а претензии по стране выросли на 293%. Ваш каталитический нейтрализатор помогает вашему автомобилю с его выбросами, превращая токсичные вещества в менее токсичные загрязняющие вещества. Вам может быть интересно, почему вор захочет заполучить его, и ответ прост: драгоценный металл, из которого он сделан, может принести ему несколько сотен долларов или больше на большинстве свалок. Угон вашего автомобиля или одной из его частей является одним из самых стрессовых событий, которые могут случиться с вами.Замена каталитического нейтрализатора — это… читать дальше

      Какие существуют типы утечек жидкости?

      Опубликовано 25 февраля 2022 г.

      Ваш автомобиль в значительной степени зависит от нескольких жидкостей, которые обеспечивают охлаждение, питание и смазку двигателя и других систем. Со временем вы можете обнаружить некоторые из этих жидкостей в луже под автомобилем. Когда это происходит, вы обнаружили утечку жидкости. Некоторые утечки жидкости требуют немедленного внимания и ремонта, в то время как другие не столь серьезны. Мы рассмотрим некоторые основы анализа утечек жидкости.Типы жидкостей, которые могут протекать Хотя вы можете предположить, что жидкость, вытекающая из вашего автомобиля, представляет собой бензин или моторное масло, жидкостей больше, чем двух. Ниже приведены некоторые из жидкостей вашего автомобиля, которые могут представлять собой лужу на земле: Тормозная жидкость — этот желтоватый раствор отвечает за включение тормозов. Хотя этот тип утечки редко случается в современных автомобилях, он все же возможен. Охлаждающая жидкость (или антифриз). Охлаждающая жидкость представляет собой раствор яркого цвета, обычно розового, оранжевого или зеленого цвета, который помогает поддерживать температуру двигателя.Охлаждающая жидкость представляет собой липкую сиропообразную жидкость, которая склонна к утечкам … читать дальше

      После того, как любовь ушла

      Опубликовано 01.02.2022

      Изображение AD_Images на Pixabay есть шрамы и история любви, которую вы потеряли на этом пути? Кажется, что только самые знающие, заинтересованные и любящие из нас никогда не чувствуют жало остывшей любви. Рано или поздно мы все чувствуем разбитое сердце, отвержение или скучаем по тому чувству, которое у нас было, когда любовь была новой, и мы не могли дождаться, чтобы снова увидеть своего партнера.Иногда трудно сохранить отношения живыми и здоровыми. Требуется постоянная работа. Пренебрегайте этим, и в конце концов вы увидите, как все начинает разваливаться. Отнеситесь к этому правильно, и вы сможете прожить вместе десятилетия. И это может быть дорогостоящим, как с точки зрения ваших денег, так и вашего времени. Нет, я не говорю о вашем браке или вашей возлюбленной. Я говорю о ваших отношениях с машиной. И это действительно отношения с вашим автомобилем. Yo … читать дальше

      Романтические идеи для свиданий в Хантингтон-Бич, Калифорния

      Опубликовано 11.01.2022

      В преддверии Дня святого Валентина мы подумали, что вы могли бы воспользоваться некоторыми местными рекомендациями по идеям для свиданий.Все, что вам нужно, это пристегнуться со своей возлюбленной и отправиться на одно из этих романтических мероприятий. Посетите курортный спа-центр на берегу океана Нет ничего более романтичного, чем спа-день для двоих. Погрузитесь в чувственные ароматы во время отдыха на выходных с помощью массажа, ухода за лицом и многого другого. Мы гарантируем, что вы и ваш близкий человек получите удовольствие от столь необходимого отдыха. Одна из наших главных рекомендаций в этом районе — спа-центр Waterfront Spa в Хантингтон-Бич. Совершите прогулку на природе Вы и ваш партнер сможете насладиться прекрасной погодой, прогуливаясь рука об руку во время этого прекрасного отпуска.Если вы решите прогуляться по экологическому заповеднику Болса-Чика, Центральному парку Хантингтона или пирсу Хантингтон-Бич, это создаст настроение. Проведите дегустацию пивоварни, вина или винокурни. Если вы и ваш С.О. хотите в нем хорошо провести время, предлагаем посетить дегустационный зал. Вот некоторые из наших любимых в т … читать дальше

      10 полезных руководств для новых водителей

      Опубликовано 01.01.2022

      Фото Яна Баборака на Unsplash время обучения кого-то в вашем доме, как водить в первый раз.Это может быть нервным для родителей и детей, пытаясь сделать работу серьезной и сосредоточенной, не пугая нового водителя. Первое, что мы хотели бы порекомендовать, — это поставить вашему юному водителю несколько целей, тесты навыков, которые он будет проходить под вашим присмотром. Мы рекомендуем вам загрузить этот PDF-файл из Детской больницы Филадельфии в качестве отличного контрольного списка для овладения всеми необходимыми навыками. (На их веб-сайте есть много отличных рекомендаций.) Обязательно проверяйте их подготовку, когда они садятся за руль.Убедитесь, что они правильно отрегулировали рулевое колесо, сиденье и зеркала… читать дальше

      Безопасно ли управлять автомобилем, если у вас гвоздь в шине?

      Опубликовано 08.12.2021

      Если честно, то ответ: нет, ездить с гвоздем в шине очень небезопасно. Всякий раз, когда какой-либо посторонний предмет застревает в вашей шине, шансы на выброс значительно увеличиваются. Например, гвоздь вызовет утечку воздуха в шине. Если вы едете на высокой скорости с недостаточно накачанной шиной, вы можете получить прокол, в результате чего ваши шины взорвутся.Как только это произойдет, вы потеряете контроль над своим автомобилем и повысите свои шансы на аварию. Вышеописанная ситуация, несомненно, является наихудшим сценарием. В некоторых случаях гвоздь в вашей шине пока может быть безвреден. Иногда штифт может застрять в протекторе настолько сильно, что физически блокируется, не позволяя воздуху выходить. Однако безобидный спайк может недолго оставаться дружелюбным. Если гвоздь сдвинется или вонзится в шину глубже, он может открыть небольшое отверстие для утечки воздуха.Вот почему важно как можно скорее устранить эту проблему в автомастерской, чтобы вы … читать дальше

      5 лайфхаков для семейного отдыха

      Опубликовано 01.12.2021

      Фото Сергея Тарасова на Unsplash   Наконец-то наступил декабрь, и впереди много ожиданий прекрасного отпуска. Ехать «через реку и через лес к бабушкиному дому» — американская традиция, такая же стара, как межгосударственная система, и у нее есть свои прекрасные традиции и подводные камни.Путешествие в отпуск может быть прекрасным, а может быть ужасным. Это действительно зависит от того, кто путешествует и что они думают об опыте в дороге. К счастью, после почти 75 лет путешествий по шоссе мы узнали кое-что о том, как сделать поездку в отпуск менее застойной. Несмотря на то, что технологии, кажется, все больше уводят нас в себя, поездка в отпуск может стать прекрасным форумом для воссоединения с семьей; таким образом, чтобы они чувствовали себя любимыми и счастливыми. Вот 5 советов, которые помогут вам и вашей семье получить больше удовольствия от поездки.Проявите должную осмотрительность! Погода, пробки и местные события часто указываются в путешествии … читать далее

      Починить все за ОДИН небольшой ежемесячный платеж Специальное предложение

      Опубликовано 24.11.2021

        Сегодня вы можете починить свой автомобиль за один небольшой ежемесячный платеж! В HB Auto & AC мы предлагаем Fix Everything For ONE Low Monthly Payment Special . Больше не нужно беспокоиться об оплате крупных счетов за ремонт. Теперь вы можете отремонтировать свой автомобиль и уехать домой уже сегодня без наличных денег! Вот как это работает     Бесплатная 30-минутная практическая диагностика (где мы узнаем, что НЕОБХОДИМО исправить)     Бесплатная оценка полной стоимости ремонта    Затем установите для вас низкие ежемесячные платежи, НУЛЕВЫЕ наличные деньги из кармана в течение 30 дней и БЕЗ КРЕДИТА НУЖНЫЙ.Бесплатный заезд/вывоз (в пределах 5 миль)    Великолепная общенациональная гарантия на 3 года / 36 000 миль, чтобы убедиться, что у вас не возникнет проблем с ремонтом в будущем    Оплатите ремонт в течение 6 месяцев с нулевой процентной ставкой    Назначьте встречу сегодня! &nbsp … читать дальше

      Почему нельзя летать над лежачими полицейскими

      Опубликовано 05.11.2021

      Водители в Калифорнии наверняка хорошо знакомы с лежачими полицейскими. Их можно найти в школьных зонах, жилых поселках, на торговых парковках.И иногда они кажутся неизбежными. Они используются в местах, где превышение скорости является частой проблемой или угрозой безопасности, поэтому они предназначены для того, чтобы заставить вас снизить скорость. Однако некоторые водители могут не заметить их, проявить нетерпение или безрассудство и в конечном итоге наехать на один из таких неровностей. Наезд автомобиля на лежачего полицейского может быть очень вредным для вашего автомобиля, и мы здесь, чтобы рассказать вам, почему. Различные области, которые могут быть затронуты Слишком быстрое движение по лежачему полицейскому подобно наезду на выбоину на высокой скорости.Толчок, который вы почувствуете после этого, может вызвать серьезные проблемы с выравниванием вашего автомобиля, пружинами, амортизаторами, стойками и/или шаровыми шарнирами. Это может даже изменить давление в шинах или привести к тому, что шина лопнет. Наконец, он может поцарапать ходовую часть автомобиля и повредить выхлопную систему. Как правильно проехать S … читать далее

      Как выразить благодарность своему автомобилю

      Опубликовано 01.11.2021

      Фото autowelt_2014 на Pixabay Добро пожаловать в ноябрь! Это месяц нового знакомства с нашими семьями, когда начинается курортный сезон.В Соединенных Штатах мы разделяем ежегодную традицию большого обеда из индейки с семьей, чтобы отметить благодарных паломников. После трудного перехода через Атлантический океан они прибыли столетия назад и сумели процветать в первый же год своего существования. И мы должны выразить благодарность всем участникам нашей истории, которые нам помогают:   ·  Семьям, которые любят и поддерживают нас. · Друзья, которые заботятся о нас. · Соседи, которые нас принимают и уважают. · Даже домашние животные, которые любят нас, несмотря на наши недостатки.Как владелец автомобиля, где бы вы были, если бы завтра ваша машина отказалась заводиться? Наши автомобили выстояли в ужасных условиях для многих водителей, сумели проехать много миль на выхлопных газах, справиться с выбоинами, ухабами и почти … читать дальше

      Взгляд на механизм действия сильно разведенных биологических препаратов

      Ключевые моменты

      • Сильно разведенные антитела к IFN-γ индуцируют конформационные изменения в IFN-γ.

      • Высокоразведенные антитела к IFN-γ улучшают связывание IFN-γ с рецептором IFN-γ.

      • Высокоразведенные антитела к IFN-γ повышают выживаемость мышей с инфекцией гриппа А.

      Abstract

      Терапевтическое использование АТ в лечении рака, аутоиммунитета, трансплантологии и других областях является одним из основных биофармацевтических достижений 20-го века. Более широкое использование препаратов на основе антител сдерживается высокой стоимостью их производства и частыми побочными эффектами. Одним из многообещающих подходов для преодоления этих ограничений является использование сильно разбавленных АТ, которые получают путем постепенного снижения концентрации АТ до чрезвычайно низкого уровня.Эта технология была использована для создания группы препаратов для лечения различных заболеваний в зависимости от специфичности используемых АТ. Было показано, что высокоразведенные антитела к IFN-γ (hd-анти-IFN-γ) эффективны против гриппа и других респираторных инфекций в различных доклинических и клинических исследованиях. В текущем исследовании мы приводим доказательства возможного механизма действия hd-анти-IFN-γ. Используя спектроскопию ядерного магнитного резонанса высокого разрешения в растворе, мы показываем, что лекарство индуцирует конформационные изменения в молекуле IFN-γ.Изменения химического сдвига произошли в аминокислотах, расположенных в основном на поверхности димера и в С-концевой области IFN-γ. Эти молекулярные изменения могут иметь решающее значение для функции белка, о чем свидетельствует наблюдаемое HD-анти-IFN-γ-индуцированное увеличение специфического связывания IFN-γ с его рецептором в клетках U937, усиленная индуцированная продукция IFN-γ в культуре РВМС человека и повышение выживаемости мышей, инфицированных гриппом А.

      Сноски

      • Работа выполнена при поддержке ООО «НПФ «Материа Медика Холдинг», Москва, Российская Федерация.

      • Сотрудники ООО «НПФ «Материа Медика Холдинг» принимали участие в планировании экспериментов и написании рукописи, проводили статистический анализ и принимали решение о публикации работы.

      • Электронная версия этой статьи содержит дополнительные материалы.

      • Сокращения, используемые в этой статье:

        1D
        одномерный
        2D
        2D
        Двухмерный
        HD-IFN-γ
        Очень разбавленный AB для IFN-γ
        HDN-Anti –TNF-α
        высокоразбавленные антитела к TNF-α
        HSQC
        гетероядерная одиночная квантовая когерентность
        IFNGR1
        рецептор IFN-γ 1
        ЯМР
        ядерный магнитный резонанс.
      • Поступило 29 января 2020.
      • Принято 4 июля 20209.
      • Copyright © 2020 Американской ассоциацией иммунологий, Inc.

      Автор BlackPos Malware утверждает свою невиновность и хорошую веру Дела

      Благодаря эффективному расследованию, проведенному частными фирмами, такими как IntelCrawler, автор BlackPOS был установлен и заявляет о своей невиновности и добросовестности.

      Я был в официальном источнике, чтобы обнаружить 23-летнего подростка, который разработал вредоносное ПО BlackPOS благодаря разоблачениям, сделанным фирмой IntelCrawler, специализирующейся на киберразведке.

      Автор BlackPOS был известен на подпольном рынке как « ree[4] », исследователи IntelCrawler при первом анализе идентифицировали Сергея Тарасова, но после дальнейшего расследования нашли нужного человека, 23-летнего молодого хакера по имени Ринат Шабаев, вероятно, сотрудничал с Сергеем Тарасповым, который оказал ему техническую поддержку при разработке вредоносного кода.

      В предыдущих отчетах фирмы Cyber ​​Intelligence ‘ IntelCrawler ‘ назывался Сергей Тарасов, 17-летний подросток по прозвищу «ree [4]», как разработка вредоносного ПО Black POS, согласно расследованию, был использован вредоносный код для заражения систем в Target и, возможно, также в Neiman Marcus, двух крупнейших розничных сетях США.

      Цифры, связанные с утечкой данных Target, вызывают беспокойство, кредитные и дебетовые карты и личная информация, принадлежащая почти 110 миллионам потребителей, находятся под угрозой.

      Судя по всему, Ринат Шабаев, также известный как ree[4], и подросток Сергей Тараспов совместно разработали вредоносное ПО BlackPOS, но они не несут ответственности за кражу данных в магазине Target, согласно расследованию, они разработали вредоносный агент чтобы продать его другим преступным группировкам, базирующимся в Восточной Европе.

      Ринат Шабаев признал, что разработал вредоносное ПО BlackPOS, в интервью, которое он дал российскому информационному агентству LifeNews, он отстаивал свою позицию, утверждая, что вредоносный код был разработан для тестирования безопасности, а не для кражи данных.Он подтвердил, что получил поддержку от другого анонимного кодера, с которым он познакомился в Интернете, и который, возможно, добавил к нему больше возможностей.

      Его намерение состояло в том, чтобы продать эксплойт, и он также отметил, что знает, что вредоносное ПО также может быть использовано в злонамеренных целях, но он никогда не думал о какой-либо незаконной деятельности, такой как кража данных.

      «Есть готовая программа, я взял и написал ей дополнение к сохраненным данным в файле и сервер дал сбой. Изначально планировалось продавать программу, большинство ей не пользуется.Идеей поделился с другим человеком. Программа предназначена для захвата данных. То есть, скорее, скопировать данные кредитной карты, — рассказал Шабаев. – Не знаю, почему это название – «картоху». Мы взяли эту программу «картоху» и допиливаем к ней дополнение. Онлайн сотрудничество предлагала эта программа, но я не хотел сотрудничать, просто дал программу и все. Если вы используете это программное обеспечение со злым умыслом, вы можете хорошо заработать, но это незаконно. Так я и не хочу этого делать, просто написал на продажу, чтобы самому не пользоваться, и пусть люди пользуются, и у них все будет на совесть.— это перевод с российского канала.

      Теперь у ИТ-безопасности есть еще одна проблема, которую нужно решить, BlackPOS находится в чужих руках, и миллионы людей страдают от кражи кредитных карт, с другой стороны, правоохранительным органам придется судить молодого человека, который заявляет о своей невиновности и добросовестности.
      Откровенно говоря, я считаю, что мальчик напуган, обе стороны, правоохранительные органы и криминальные организации, которые приобрели BlackPOS, будут уделять много внимания признаниям юноши.
      Страшная штука!

      Поделиться

      Механизмы связывания нефосфорилированного фактора транскрипции STAT3 с ДНК

      J Biol Chem. 20 апр. 2012 г.; 287(17): 14192–14200.

      , § § §, 1, 2 , § , , , , , ** , § , ‡ ‡ , , , , § и § §

      Ольга А.Тимофеева

      Департаментов онкологии,

      § радиационной медицины,

      Сергей Часовских

      § радиационной медицины

      Ирина Лонская

      ¶ Neuroscience,

      Nadya И. Тарасова

      Программа рака и воспаления ,

      Lyuba Khavrutskii

      Программа рака и воспаления

      ‖ ,

      Сергей Г. Тарасов

      ** Биофизика Ресурсный ядра, Лаборатория структурных биофизиков, NCI-Frederick, Фредерик , Maryland 21702

      Xueping Zhang

      Из отделений Онкология,

      § Радиационная медицина,

      Валерий Р.Korostyshevskiy

      ‡‡ Биостатистика, биоинформатики и биоматематики и

      Амрита Чима

      Департаментов онкологии,

      Lihua Zhang

      Департаментов онкологии,

      Sivanesan Dakshanamurthy

      из отделов

      ‡ Онкологии

      ‡ ,

      Милтон Л. Браун

      из отделов Онкологии

      ,

      §§

      Программа открытия наркотиков, Ломбарди Комплексный рак, Джорджтаун Университетский медицинский центр, Вашингтон, Д.С. Neuroscience,

      ‡‡ Биостатистика, биоинформатика и биоматематика и

      §§ Программа открытия лекарств, Комплексный онкологический центр Ломбарди, Медицинский центр Джорджтаунского университета, Вашингтон, округ Колумбия.C. 20057 и

      the Cancer and Inflammation Program,

      ** Biophysics Resource Core, Structural Biophysics Laboratory, NCI-Frederick, Frederick, Maryland 21702

      2 отделения онкологии, исследовательский корпус, R. E216, 3970 Reservoir Rd., NW, Washington, DC 20057-1482., тел.: 202-687-8810; Факс: 202-687-2221; Электронная почта: [email protected]

      1 Оба автора внесли одинаковый вклад.

      Поступила в редакцию 15 ноября 2011 г.; Отредактировано 27 февраля 2012 г.

      Copyright © 2012 г. Американского общества биохимии и молекулярной биологии, Inc.

      Abstract

      Фосфорилирование преобразователя сигнала и активатора транскрипции 3 (STAT3) по одному остатку тирозина в ответ на ростовые факторы, цитокины, интерфероны и онкогены активирует его димеризацию, транслокацию в ядро, связывание с интерфероном γ (гамма) -активированная последовательность (GAS) сайта связывания ДНК и активация транскрипции генов-мишеней.STAT3 конститутивно фосфорилируется при различных видах рака и управляет экспрессией генов с GAS-содержащих промоторов, способствуя онкогенезу. Недавно была описана роль нефосфорилированного STAT3 (U-STAT3) в ответ на стимуляцию цитокинами, при раке и в поддержании стабильности гетерохроматина. Однако механизмы, лежащие в основе связывания U-STAT3 с ДНК, полностью не исследованы. Здесь мы исследуем взаимодействие STAT3-ДНК с помощью атомно-силовой микроскопии (АСМ). Мы наблюдали, что молекулы U-STAT3 связываются с сайтом связывания ДНК GAS в виде димеров и мономеров.Кроме того, мы наблюдали, что U-STAT3 связывается с участками последовательности ДНК, богатыми AT, и распознает специфические структуры ДНК, такие как 4-сторонние соединения и узлы ДНК, в отрицательно сверхскрученной плазмидной ДНК. Эти структуры важны для организации хроматина, и наши данные предполагают роль U-STAT3 как организатора хроматина/генома. Неожиданно мы обнаружили, что укороченная на С-конце изоформа STAT3 67,5 кДа распознает одноцепочечные спейсеры в крестообразных структурах, которые также играют роль в организации хроматина и экспрессии генов.Эта изоформа, по-видимому, широко распространена в ядрах раковых клеток и, следовательно, может играть роль в регуляции экспрессии генов. В совокупности наши данные подчеркивают новые механизмы, с помощью которых U-STAT3 связывается с ДНК и поддерживает функцию U-STAT3 в качестве активатора транскрипции и организатора хроматина/генома.

      Ключевые слова: Атомно-силовая микроскопия, структура ДНК, фактор транскрипции STAT, STAT3, факторы транскрипции, связывание ДНК, микромасштабный термофорез белки, которые активируются в ответ на внеклеточные лиганды, такие как цитокины, факторы роста и гормоны (1).Семь белков STAT млекопитающих, STAT1, STAT2, STAT3, STAT4, STAT5A, STAT5B и STAT6, имеют общие консервативные структурные и функциональные домены: N-концевой, спиральный, ДНК-связывающий, Src-гомология 2 и С-концевой. домен, содержащий консервативный сайт фосфорилирования тирозина (2). Белки STAT необходимы для различных биологических процессов, включая эмбриональное развитие и гомеостаз взрослых, а также дифференцировку, пролиферацию, выживание и апоптоз (3). Цитокины или факторы роста, связывающиеся с родственными им рецепторами, приводят к привлечению STAT к рецепторам и фосфорилированию членами семейства киназ Janus (JAKs) или киназами Src по одному остатку тирозина (Tyr 705 в STAT3) (1, 2).Этот процесс называется «активацией» STAT, запуская димеризацию и ядерную транслокацию белков STAT. В ядре фосфорилированные STAT (P-STAT) связываются с реагирующими на ДНК элементами, называемыми интерферон-гамма-активируемой последовательностью (GAS) 3 , в промоторах генов-мишеней и активируют специфические программы экспрессии генов (1). Для STAT 1, 3, 4, 5A и 5B были идентифицированы две основные изоформы STAT: α-изоформы полноразмерного транскрипционного фактора и альтернативно сплайсированные β-изоформы, в которых отсутствует домен трансактивации (4).Изоформы STAT, так называемые STATγ, также могут образовываться в результате протеолиза (4). Как в альтернативном сплайсинге STATβ, так и в протеолитически расщепленном STATγ отсутствует домен трансактивации, и считается, что они отрицательно регулируют транскрипцию (5).

      В нормальных клетках и тканях лиганд-зависимая активация STAT представляет собой преходящий процесс, длящийся от нескольких минут до нескольких часов (2). Однако во многих раковых клетках с нарушенной регуляцией передачи сигналов фактора роста белки STAT конститутивно активируются путем фосфорилирования тирозина (2).В этом отношении STAT3α выделяется на фоне его конститутивного фосфорилирования в большинстве новообразований человека и его способности индуцировать клеточную трансформацию и онкогенез (6). Считается, что P-STAT3α опосредует свои онкогенные эффекты через транскрипционную активацию генов-мишеней для усиления пролиферации ( CCND1 и c- MYC ), ангиогенеза ( VEGF , ADM и ANGPTL4 ), инвазии ( FGA , FGB , FGB , CTSB и SERPINE2 и SERPINE2 ) и подавление апоптоза ( BCL-XL , BCL-2 , MCL-1 и BIRC5 ) (7).Кроме того, P-STAT3α стимулирует собственную транскрипцию, вызывая увеличение нефосфорилированного STAT3α (U-STAT3) (8–10).

      Белки U-STAT перемещаются между цитоплазматическими и ядерными компартментами (11) и влияют на транскрипцию генов как в ответ на цитокины, так и в раковых клетках с помощью механизмов, отличных от механизмов, лежащих в основе P-STAT3 (10). Кроме того, исследования Drosophila показали, что U-STAT92E локализуется в ядре в ассоциации с гетерохроматин-ассоциированным белком HP1 и необходим для поддержания стабильности гетерохроматина.Активация STAT92E путем фосфорилирования вызывает рассредоточение STAT от гетерохроматина, что приводит к диссоциации HP1 от ДНК и дестабилизации гетерохроматина (12, 13). Следовательно, нефосфорилированный STAT3 может быть важным регулятором экспрессии генов, что подчеркивает необходимость понимания механизмов, лежащих в основе связывания ДНК и регуляции экспрессии генов с помощью U-STAT3.

      Здесь мы использовали атомно-силовую микроскопию (АСМ) для прямой оценки связывания U-STAT3 с ДНК в модельной системе. Мы наблюдали, что U-STAT3 может связывать мотив GAS как мономер, так и димер.Кроме того, мы наблюдали, что U-STAT3 связывается с последовательностями ДНК, богатыми AT, и распознает определенные структуры ДНК, такие как 4-сторонние соединения и узлы ДНК. Наши данные подтверждают функцию U-STAT3 в качестве архитектурного белка и регулятора экспрессии генов.

      ЭКСПЕРИМЕНТАЛЬНЫЕ ПРОЦЕДУРЫ

      Реакции связывания STAT3-ДНК для АСМ-визуализации

      Реакционные смеси, содержащие 20 нг плазмидной ДНК и 100 нг молекул рекомбинантного белка STAT3 (Active Motif, Carlsbad, CA), инкубировали на льду в течение 15 мин, а затем перекрестно -связано 0.5% глутаровый альдегид. После завершения стадии фиксации комплексы очищали с использованием фильтров Montage PCR (Millipore Corp., Bedford, MA). Конечные образцы ресуспендировали в 20 мкл 10 мМ Tris-HCl (рН 7,4), 5 мМ буфера NaCl. Для нанесения образцов на слюду были сделаны соответствующие разведения, чтобы обеспечить равномерное распределение ДНК на поверхности слюды для визуализации с помощью АСМ.

      АСМ-визуализация и измерение объема белка

      Свежерасщепленную мусковитную слюду инкубировали в смеси с раствором 1-(3-аминопропил)силатрана (АПС) в течение 30 мин для получения АПС-слюды, как описано (14).Капли образца (5 мкл) наносили на АПС-слюду на 2 мин, затем промывали деионизированной водой и сушили газообразным азотом. Изображения были получены в режиме постукивания с использованием системы Multimode SPM Nanoscope IIIa (Veeco/Digital Instruments, Санта-Барбара, Калифорния). Использовались кремниевые датчики постукивания (Hi’Res DP14; MicroMasch, Эстония) с радиусом кривизны 1 нм. Номинальные постоянные пружины составляли ~5,0 ньютон/м, а резонансная частота ~160 Гц.

      Измерения длины контура молекул ДНК были выполнены путем отслеживания основной цепи ДНК изображения с использованием программного обеспечения для работы с кривыми модуля изображения (Digital Instruments, Санта-Барбара, Калифорния).Измерения объема белка определяли с использованием программного обеспечения для срезов (Digital Instruments). Перпендикулярные сечения были двухмерными: высота (h) белка измерялась по разнице интенсивности белка по сравнению с фоновым шумом; ширину измеряли в положении, соответствующем полумаксимальной высоте белка. Объем (V) белка определяли, как описано (15, 16).

      Статистический анализ

      Количество комплексов наносили на гистограммы.Соответствующие подгонки плотности были рассчитаны с помощью оценки плотности ядра с ядрами Гаусса. Расчеты и подгонка плотности были выполнены с использованием статистического пакета R (R Foundation for Statistical Computing, Вена, Австрия) (17). Для сравнения распределения объемов мономеров и димеров в местах связывания ДНК для GAS и 4-сторонних соединений использовали бутстрап-тест Колмогорова-Смирнова.

      Клеточные линии, фракционирование клеток и вестерн-блоттинг

      Клеточные линии MCF-7, DU145, PC-3 и LNCaP были получены из Американской коллекции типовых культур (ATCC).Клетки культивировали в соответствии с рекомендациями производителя. Для клеточного фракционирования клетки высевали в чашки диаметром 100 мм, собирали через 2 дня и готовили цитоплазматический и ядерный экстракты, как описано (18). Вестерн-блоттинг проводили с антителом против STAT3 (H-190) из Санта-Крус (Санта-Крус, Калифорния), как описано (19).

      Анализы преципитации аффинности ДНК

      Анализы преципитации аффинности ДНК (DAPA) проводили, как описано (20). Вкратце, клетки лизировали в буфере для лизиса клеток (50 мМ Трис-HCl (pH 8), 0.5% игепал, 150 мМ NaCl, 1 мМ ЭДТА и 10% глицерин, дополненные ингибиторами протеазы и фосфатазы) для получения общих клеточных экстрактов. Перечисленные биотинилированные олигонуклеотиды ДНК инкубировали со стрептавидин-агарозными гранулами (Chemicon) в IP-буфере (буфер для лизиса клеток, содержащий 15 мМ NaCl) при 4 °C в течение 2 часов. Комплекс олигогранул промывали и инкубировали с клеточным экстрактом в IP-буфере при 4°C в течение ночи. Гранулы промывали два раза, ресуспендировали в загрузочном буфере для SDS-PAGE, кипятили и анализировали на гелях SDS-PAGE перед иммуноблоттингом с антителом против STAT3.

      Таблица 1

      Таблица 1

      AFM-идентифицированные последовательности, связанные at3 в PGAS-Ta-Luc Plasmid

      сайт Расстояние от сайта Noti соответствующие последовательности
      85- 110 п.о. (S + 100) 5′- А.А. AACAAA ACG AAACAAACAAA сТО
      (S-100) 5′- CGCAACTGTTGGGAAGGGCGATCG
      S333 320-350 п.н. (S + 330) 5′- CGC CAAAAA CATAAAGAAAG
      (S-330) 5′- GTTTTT CGCCCTTTGACGTTG
      ГАЗ 167-195 п.н. (газ) 5′- GT GT TTCCGGGGGAA agcagtagggt TTCCGGGGGAA AG -3 '
      S + 100 S + 100 S + 100 Mut # 1 Aaaaca G AACGA G АСА G ACAAACTA
      мутанты S + 100 Mut # 2 А.А. Г.Г. CA Г.Г. ACGA Г.Г. CA Г.Г. CA Г.Г. CTA
      Микромасштабный термофорез Исследования связывания ДНК

      Связывание белка STAT3 с олигонуклеотидами измеряли с помощью микромасштабного термофореза (21–23).Клетки HEK293 трансфицировали вектором экспрессии STAT3-GFP, как описано (19). В качестве источника флуоресцентно-меченого STAT3 использовали лизаты клеток, приготовленные с использованием 1× буфера RIPA (Millipore Corp., Bedford, MA) (20×10 6 клеток/мл). Лизаты разбавляли в 150 раз микромасштабным термофорезным ДНК-связывающим буфером, чтобы обеспечить оптимальный уровень флуоресцентных белков STAT3 (20 нМ) в реакциях связывания. Нетрансфицированные клетки HEK293 использовали для оценки фоновой флуоресценции, которая оказалась неопределяемой даже в неразбавленном лизате.Были приготовлены серии титрования (16 смесей для связывания), содержащие постоянные количества клеточного лизата в каждом образце и различные концентрации олигонуклеотидов. Конечная буферная композиция содержала 25 мМ HEPES (pH 7,2), 50 мМ NaCl, 2,5 мМ MgCl 2 и 0,025% Nonidet P-40. Измерения проводились в стандартных обработанных капиллярах на приборе Monolith NT.115 (NanoTemper Technologies GmbH, Германия) с использованием 50% мощности ИК-лазера и светодиодного источника возбуждения с λ = 470 нм при температуре окружающей среды.Программное обеспечение NanoTemper Analysis 1.2.20 использовалось для подгонки данных и определения кажущихся значений K D .

      Формирование и выделение ДНК-гетеродуплекса

      Ранее была описана плазмида pUC8F14C, содержащая инвертированную повторяющуюся вставку длиной 106 п.н. (24). Фрагменты pUC8 длиной 301 п.н. и аналогичные фрагменты плазмиды, содержащей вставку, амплифицировали с использованием модифицированных праймеров для ПЦР (5'-биотин-CTGGCACGACAGGTTTCCCGACTG-3') и нижестоящих (5'-биотин-CTGGCGAAAGGGGGATGTGCTGCA-3') ПЦР-праймеров (Sigma Genosys). .Нити ДНК отжигали с их комплементарными аналогами для образования гетеродуплексов (25). Вкратце, каждую 25 мкл гибридизационной смеси, содержащей 1 пмоль фрагментов ДНК в 200 мМ NaCl, 50 мМ Трис-HCl (pH 8,0), 1 мМ дитиотреитола, 10 мМ MgCl 2 , инкубировали поэтапно при 95 (5 мин), 85 (10 мин) и 70 °С (60 мин), а затем охлаждали до комнатной температуры. Продукты гибридизации разделяли в 5% нативном полиакриламидном геле в буфере ТВЕ (90 мМ трисборат, рН 8,3, 2,5 мМ ЭДТА) и вырезали полосы гетеродуплексных фрагментов, которые мигрируют медленнее, чем правильно отожженные родительские фрагменты.После очистки с использованием набора для гель-экстракции GeneClean (Q-biogen, Carlsbad, CA) выделенные гетеродуплексы ресуспендировали в 40 мкл ТЕ (10 мМ Трис-HCl, 1 мМ ЭДТА, pH 7,8) и отбирали аликвоты для связывания STAT3. реакции.

      Реакции связывания STAT3

      Анализы связывания STAT3 проводили с использованием молекул рекомбинантного белка STAT3, полученных из Active Motif, при различных молярных соотношениях ДНК-белок (указанных в подписях к рисункам) в буфере, содержащем 20 мМ Трис-HCl, 50 мМ KCl, 1 мм ЭДТА, 4 мм MgCl 2 , 0.2% Nonidet P-40 и 7% глицерин (pH 7,9). Продукты анализировали на 4–12% геле ТВЕ (Novex, Invitrogen) при 100 В в течение 2 ч. Все реакции связывания (общий объем 30 мкл), содержащие эквимолярные количества ДНК-зондов (1,7 нм) и различные количества белков, инкубировали в течение 30 мин при 37 °С. Продукты реакции наносили на 3,5% нативные полиакриламидные гели, содержащие 5% глицерина, и разделяли электрофорезом при 100 В в буфере ТВЕ в течение 2 ч. ДНК визуализировали, как описано (25).

      РЕЗУЛЬТАТЫ

      Чтобы исследовать связывание U-STAT3 с мотивом GAS, рекомбинантные белки STAT3 инкубировали с плазмидой pGAS-TA-Luc для визуализации с помощью АСМ.Эта плазмида содержит два соседних мотива GAS, разделенных 10 парами оснований (TTCCGGGAAN 10 TTCCGGGAA) ( A ), и обычно используется в анализе репортеров люциферазы для изучения транскрипционной активности STAT3 в ответ на стимуляцию цитокинов и/или лекарств, направленных на димеризацию STAT3 и ДНК. привязка. Очищенные комплексы ДНК-белок были нанесены на APS-слюду и визуализированы с использованием режима постукивания АСМ, который минимизирует любую латеральную силу, приложенную к белку (, B-F ). Расчетные размеры белков STAT3, собранных на ДНК, определенные из измерений объема АСМ, составляли 359 и 208 нм 3 , что свидетельствует о том, что U-STAT3 способен связываться с ДНК в виде димера или мономера ( G ).Ожидаемые (теоретические) объемы димера STAT3α 176 кДа составляют 332 нм 3 , а мономера STAT3α 88 кДа составляют 166 нм 3 . Расхождения между теоретическим и предполагаемым объемами STAT3 могут быть связаны с коллапсом, уплощением или искажением белка из-за высыхания образца перед АСМ-визуализацией. Однако, поскольку целью данного исследования было различение димеров и мономеров, относительные значения являются информативными.

      АСМ-визуализация комплексов STAT3 с плазмидой pGAS-TA-Luc. A , план эксперимента для АСМ-анализа связывания STAT3 с элементом GAS в pGAS-TA-Luc. B, репрезентативное АСМ-изображение полноразмерного STAT3 ( белая стрелка ), связывающегося в качестве мономера с pGAS-TA-Luc. C , полноразмерный STAT3, связывающийся с элементом GAS в виде димера (, белая стрелка, ). D, % белковых комплексов связывались с одним или двумя сайтами на плазмиде pGAS-TA-Luc. E, репрезентативное АСМ-изображение STAT3, связанного с двумя сайтами ( белые стрелки ). F , связывание STAT3 с сайтом, расположенным на расстоянии 100 п.н. от конца, расщепленного NotI. G , гистограмма объемного распределения полноразмерного STAT3, измеренная с помощью АСМ. H , взаимодействия STAT3-ДНК, проанализированные с помощью DAPA с биотинилированными олигонуклеотидами двухцепочечной ДНК, соответствующими каждому из четырех потенциальных сайтов связывания STAT3 в плазмиде pGAS-TA-Luc. I , связывание STAT3 с AT-богатыми последовательностями снижается за счет мутаций от A до G.

      Чтобы подтвердить связывание STAT3 с элементом GAS в pGAS-TA-Luc, мы расщепляли плазмиду, связанную со STAT3, с помощью NotI и SphI.Расщепление плазмиды pGAS-TA-Luc размером 4,8 т.п.н. дает два фрагмента ДНК: короткий фрагмент ДНК размером 0,9 т.п.н., содержащий мотив связывания ДНК GAS, и длинный фрагмент ДНК размером 3,9 т.п.о. без сайта связывания STAT3. Очищенные короткие фрагменты ДНК и белковые комплексы наносили на АПС-слюду для АСМ-визуализации. Расстояния от сайта NotI до элемента GAS в пределах коротких фрагментов ДНК составляют 167 п.н., а от элемента GAS до сайта SphI – 750 п.н. ( A ). C демонстрирует, что полноразмерный белок U-STAT3 связывается с элементом GAS в виде димера.

      Наше наблюдение, что 20 из 62 (31%) проанализированных комплексов ДНК STAT3-плазмида содержали STAT3, связанный в двух сайтах ( D ), было неожиданным открытием. Второй сайт связывания явно не был консенсусным элементом GAS, поскольку он был отделен от первого сайта связывания более чем на 10 пар оснований ( E ). Это указывает на то, что U-STAT3 способен связываться с последовательностями, которые могут лежать в основе альтернативных механизмов регуляции экспрессии генов с помощью U-STAT3. Чтобы охарактеризовать второй сайт связывания, мы расщепляли pGAS-TA-Luc, связанный со STAT3 в одном сайте, с помощью NotI, чтобы получить линейную 4.Фрагмент размером 8 т.п.н., как показано на A . Измеренные расстояния от концов плазмид показали, что STAT3 связывается с сайтами ДНК, расположенными на расстоянии 100 и 323 п.н. от концов линеаризованной плазмиды pGAS-TA-Luc ( F ). Последовательности, соответствующие этим потенциальным сайтам связывания, перечислены в .

      Чтобы подтвердить наблюдения АСМ и подтвердить, что U-STAT3 связывается с идентифицированными последовательностями ДНК, мы выполнили DAPA путем инкубации ядерных экстрактов из клеток рака предстательной железы DU145 с двухцепочечными меченными биотином олигонуклеотидами, соответствующими мотиву GAS, и новым связыванием, идентифицированным АСМ. места.Поскольку измерения АСМ не различают концы, генерируемые NotI, для дальнейшего определения областей связывания STAT3 мы синтезировали двухцепочечные олигонуклеотиды, соответствующие ДНК в положениях +S100, -S100, +S333 и -S333. Скремблированные последовательности ДНК использовали в качестве отрицательного контроля. Анализы DAPA показали, что STAT3 предпочтительно связывается с последовательностями S+100 и S+330 ( H ). Кроме того, более слабое связывание наблюдалось с последовательностью S-330. Примечательно, что не было сходства в последовательностях ДНК S+100, S+330 и S-330, за исключением того, что они обогащены гексануклеотидами AT (5'-AAACAA, 5'-AACAAA и 5'-CAAAAA) ().Они представлены среди гексануклеотидных последовательностей, часто встречающихся в областях, прикрепленных к каркасу/матриксу (S/MAR) (26, 27). Мутации в AT-богатых олигонуклеотидах, несущих замену A на G, аннулировали связывание STAT3 с идентифицированными последовательностями ( I ).

      Мы использовали микромасштабный термофорез для определения относительной аффинности STAT3 к GAS и богатому AT олигонуклеотиду S+100 (). Метод основан на индуцированном связыванием лиганда изменении движения флуоресцентных молекул вдоль температурного градиента (21–23).Мы использовали лизаты клеток HEK293, экспрессирующих STAT3-GFP, в качестве источника флуоресцентно-меченого STAT3 для анализа связывания ДНК. Поскольку слитый белок U-STAT3-GFP является единственной флуоресцентной молекулой в лизатах, взаимодействия слитого белка можно изучать без очистки. Флуоресценция контрольных лизатов нетрансфицированных клеток не определялась. Связывание высокозаряженных олигонуклеотидов приводило к значительным изменениям подвижности STAT3 в температурном градиенте и позволяло определять кажущиеся константы диссоциации.Кажущиеся константы диссоциации составили 37,9 ± 1,0 и 23,3 ± 0,6 мкм для GAS и S+100 соответственно (). Поскольку анализы связывания проводились в идентичных условиях с использованием одних и тех же препаратов лизатов для всех олигонуклеотидов, это позволило сделать вывод о том, что U-STAT3-GFP связывается с AT-богатыми (S+100) последовательностями с аффинностью в 1,6 раза выше по сравнению с элементом GAS. Специфичность связывания STAT3 с AT-богатой ДНК была подтверждена заменами A на G, что привело к резкому снижению аффинности S+100 мутанта 1 и неспособности связываться с S+100 мутантом 2 (и).Мы интерпретируем данные, полученные с помощью АСМ, DAPA и микромасштабного термофореза, как подтверждающие связывание U-STAT3 с идентифицированными последовательностями ДНК, богатыми AT и GAS.

      Связывание STAT3 с ДНК. Измерения микромасштабного термофореза связывания STAT3-EGFP с GAS ( K D = 37,9 ± 1,0 мкм), S+100 ( K D = 23,3 ± 0,57 мкм), S+100 мутант 80 K 1 (

    • 1 = 23,3 ± 0,57 мкм) D = 740 ± 21 мкм) и мутант 2 S+100 (без связывания). Данные свидетельствуют о сравнимой аффинности взаимодействий STAT3 с последовательностями, богатыми GAS и AT, тогда как замены A на G в последовательности S+100 (мутанты S+100 1 и мутант S+100 2) приводят к резкому снижению аффинности. линий через точки являются наиболее подходящими кривыми с использованием уравнения Хилла. Столбики ошибок представляют собой стандартное отклонение от трех независимых измерений.

      Белки, которые связываются с ДНК, богатой AT, часто изгибают ДНК или преимущественно взаимодействуют с изогнутой ДНК или перекрестами ДНК (28, 29). Эти специфические структуры ДНК играют роль в организации хроматина и транскрипции генов посредством отдаленных механизмов. Чтобы определить, распознает ли U-STAT3 специфические структуры в последовательностях ДНК, мы использовали ранее охарактеризованную суперскрученную плазмиду pUC8F14C.Эта плазмида не имеет элемента GAS, но содержит палиндром из 106 пар оснований с AT-богатыми гексануклеотидами, адаптированными в крестообразной структуре с областью 4-стороннего соединения (14, 24). Мы наблюдали, что STAT3 связывается с областью 4-way junction ( A ) и узлами ДНК ( B ), поддерживая потенциальную роль организации хроматина, объединяя дистальные области ДНК.

      Связывание STAT3 со структурами ДНК в определенных модельных плазмидах. A , АСМ-изображение полноразмерного димера STAT3, связанного с областью 4-стороннего соединения в крестообразной структуре (, белая стрелка, ). B , АСМ-изображение полноразмерного димера STAT3, связанного с узловой областью (, белая стрелка, ). C, АСМ-изображение мономера STAT3 с молекулярной массой 67,5 кДа, связанного с концом шпильки в виде крестообразной структуры (, белая стрелка, ). D, показаны эмпирические кумулятивные функции распределения (функция распределения) объемов для полноразмерного STAT3, связанного с плазмидами pGAS-TA-Luc и pUC8F14C, и C-концевого укороченного 67,5 кДа STAT3, связанного с плазмидой pUC8F14C.Повышенное значение ECDF на каждом закрашенном кружке на графике представляет собой эмпирическую вероятность (, т.е. относительная частота ) соответствующего комплекса STAT3-ДНК.

      Объемы полноразмерного STAT3 (мономер 88 кДа и димер 176 кДа), связанного с pUC8F14C, несколько отличались от объемов, определенных для pGAS-TA-Luc ( и G ). Мы проверили нулевую гипотезу о том, что объемы моно- и димеров для связывания 88-кДа STAT3 в GAS-сайте и в 4-путевом соединении взяты из одного и того же распределения.Тест Bootstrap Колмогорова-Смирнова дал p = 0,846. (Число бутстрапов было установлено равным 1000; наивное значение Колмогорова-Смирнова p равно 0,918.) Мы интерпретируем эти данные в поддержку нулевой гипотезы о том, что полноразмерный STAT3 образует сходные комплексы на обеих плазмидах. Однако мы также наблюдали связывание белка с измеренными объемами 144 и 267 нм 3 с pUC8F14C, предполагая, что изоформа короче, чем полноразмерный STAT3, связывается со спейсером шпильки (и C ).Чтобы определить, являются ли эта более короткая изоформа и полноразмерный STAT3 взятыми из одного и того же распределения, тест Bootstrap Колмогорова-Смирнова дал p = 0,001 и p = 0,017 для полноразмерного STAT3, связанного с GAS и pUC8F14C, соответственно (). Д ). Анализ образца рекомбинантного белка STAT3 подтвердил наличие более короткой изоформы с молекулярной массой 67,5 кДа, которая, вероятно, возникла в результате частичного протеолиза STAT3. Использование антител к различным доменам (N-концевой, гомологии Src 2 и С-концевой) в сочетании с масс-спектрометрическим анализом показало, что эта изоформа не содержит С-концевой домен, но сохраняет ДНК-связывающий мотив (, 90–280). А и В ).Следовательно, мы рассматриваем эти наблюдения АСМ как демонстрацию связывания укороченной изоформы STAT3 специфически со спейсером в виде шпильки. Примечательно, что количество комплексов, образованных С-концевой укороченной изоформой, сравнимо с количеством комплексов, образованных полноразмерным белком STAT3, несмотря на более низкую концентрацию этой изоформы в образце белка, что позволяет предположить, что эта изоформа связывается с более высокой аффинностью. ДНК спейсера шпильки.

      ТАБЛИЦА 2

      Анализ видов U-STAT3, связанных с плазмидой pUC8F14C, на АСМ-изображенияхКомплексов Теоретические (т) объем экспериментальный (е) средний объем соотношение E / T том 67,5 кДа мономера 67,5 KDA 12 128 нм 3 144 ± 16 Нм 3 1.13 1.13 88-KDA Monomer 88 KDA 8 166 NM 3 196 ± 19 нм 3 1.18 67.5-KDA DIMER

      135 KDA 14 256 NM 3 267 ± 20 нм 3 1.04 1.04 88-KDA Dimer B 176 KDA 9 9 332 нм 3 357 ± 22 нм 3 1,08 1,08

      Характеристики Isoform 67,5 кДа IT3. A , структура домена STAT3 и сайты узнавания антител. B , Вестерн-блот анализ рекомбинантного белка STAT3 с антителами против различных доменов. C , Вестерн-блот-анализ STAT3 с антителом против N-концевого домена ( H-190 ) в экстрактах цитоплазмы раковых клеток ( C ) и ядра ( N ). D , EMSA демонстрирует, что STAT3 связывается с гетеродуплексом, содержащим структуры шпилек из 106 п.н., но не с соответствующей линейной ДНК.

      Чтобы подтвердить наблюдения АСМ связывания STAT3 со структурами шпилек в плазмидной ДНК pUC8F14C, мы также провели EMSA с рекомбинантными белками STAT3.Фрагменты ДНК, амплифицированные из pUC8F14C и исходной плазмиды pUC8, использовали для формирования гетеродуплекса, как описано ранее (25). Фрагменты гетеродуплексной и линейной ДНК инкубировали с рекомбинантным белком STAT3. Данные, представленные в D , показывают, что рекомбинантный STAT3 связывается с гетеродуплексом, содержащим шпильку, но не с линейной ДНК.

      Укороченные изоформы, STAT3γ, ранее наблюдались в определенных типах клеток (4). Мы фракционировали клетки рака молочной железы и предстательной железы на экстракты цитоплазматического и ядерного белка, чтобы определить наличие укороченных С-концевых изоформ, используя антитело против N-концевого домена STAT3.Изоформа 67,5 кДа практически не обнаруживается в экстрактах цитоплазматических белков, но легко обнаруживается в ядерных экстрактах раковых клеток MCF-7, PC3 и DU145 ( C ). Наличие ядерного 67,5-кДа STAT3, способного связываться с ДНК, предполагает, что эта изоформа может играть регулирующую роль в раковых клетках. В совокупности наши данные демонстрируют, что U-STAT3 может распознавать специфические структурные элементы ДНК, что указывает на архитектурную роль этого белка.

      ОБСУЖДЕНИЕ

      Наши экспериментальные данные являются прямым доказательством того, что U-STAT3 способен связываться с ДНК.Мы наблюдали, что U-STAT3 связывается с последовательностями GAS в виде димера или мономера, что согласуется с предыдущими наблюдениями Yang et al. (8–10), подтверждающие роль U-STAT3 в регуляции экспрессии генов. Наши данные показывают, что U-STAT3 ведет себя аналогично U-STAT1, который связывается с ДНК как мономер, контактируя с половиной палиндромного мотива GAS (30), или образует димеры посредством взаимодействий N-доменов, которые также позволяют им связываться с последовательностями GAS. in vitro , хотя и с гораздо более низким сродством по сравнению с фосфорилированным димером STAT1 (31, 32).Микромасштабный термофорез подтверждает, что U-STAT3 связывается с ДНК с низкой аффинностью (кажущаяся K D составляет 37,9 мкм). Это согласуется со значениями K D для других транскрипционных факторов (33). Наши данные свидетельствуют о том, что U-STAT3 действует как слабый, но потенциально биологически значимый фактор транскрипции благодаря его прямому связыванию с чувствительным промотором GAS.

      Однако мы обнаружили, что U-STAT3 также связывается с AT-богатыми последовательностями ДНК. Эти данные согласуются с отчетом Yoo et al. (34), демонстрирующий, что AT-богатые последовательности в промоторе α 2 -макроглобулина необходимы для STAT3- и c-Jun-зависимой синергетической активации генов. Богатые АТ области играют важную роль в регуляции экспрессии генов и/или организации хроматина благодаря их особой структуре с узкой малой бороздкой, которая может распознаваться белками (35-38). Используя микромасштабный термофорез, мы обнаружили, что U-STAT3 связывается с последовательностями, богатыми АТ, с немного более высокой аффинностью, чем с элементом GAS.Мутации нуклеотидов от A до G в гексануклеотидах 5'-AAACAA, 5'-AACAAA и 5'-CAAAAA, часто обнаруживаемые в S/MAR (26, 27), уменьшали связывание STAT3-ДНК. Элементы ДНК S/MARs активируют или ингибируют экспрессию генов косвенно, регулируя организацию петель хроматина и функционируя в качестве «платформы» для агрегации белков, ремоделирующих хроматин (38). Наши данные предоставляют доказательства, указывающие на архитектурную роль U-STAT3 в клетках посредством его связывания с 4-сторонними соединениями и пересечениями ДНК.Будущие исследования определят механизм архитектурной роли U-STAT3 в организации хроматина посредством связывания с AT-богатыми последовательностями ДНК.

      Предыдущие отчеты показали, что кажущиеся неродственными белки, которые прочно связывают in vitro с 4-канальной ДНК, по-видимому, функционируют как архитектурные белки (39, 40). Способность связывать богатые AT последовательности ДНК и распознавать структуры ДНК может быть конститутивной чертой архитектурных белков. Наиболее распространенной функцией белков, демонстрирующих связывание с перекрестной и/или изогнутой ДНК, является содействие образованию комплексов белок-ДНК или белок-белок более высокого порядка (38, 39, 41).Хорошо изученным примером является искривление ДНК, вызванное связыванием LEF-1 с центром энхансера гена Т-клеточного рецептора α, что позволяет взаимодействовать между несколькими транскрипционными факторами (41). Другая заключается в SATB1, MAR-связывающем белке, который регулирует гены, складывая хроматин в петлевой домен и привлекая другие регуляторные белки (38). Недавние отчеты Shi et al. (12, 13) о неканонической передаче сигналов JAK-STAT у Drosophila продемонстрировали, что диссоциация U-STAT от ДНК в ответ на передачу сигналов цитокинов запускает изменения в динамике хроматина.На сегодняшний день имеется мало доказательств существования этого механизма в клетках млекопитающих, хотя предполагалась роль членов семейства STAT в ремоделировании хроматина в клетках млекопитающих (42-44). Христова и др. (43) показали, что индукция транскрипции главного комплекса гистосовместимости человека требует передачи сигналов JAK-STAT для запуска ремоделирования хроматина более высокого порядка всего локуса главного комплекса гистосовместимости, предшествующего активации его транскрипции. Ши и др. (44) наблюдали, что активация JAK3-STAT5 во время дифференцировки Т-хелперов вызывает ремоделирование хроматина в локусе интерферона-γ ( Ifng ), что приводит к доступности Ifng и ацетилированию гистонов.Основываясь на наших данных, заманчиво предположить, что способность U-STAT3 напрямую связываться с AT-богатыми областями ДНК и/или с перекрестными или искривленными участками ДНК, объединяя отдаленные участки ДНК (петлеобразование ДНК) и другие белки, может лежать в основе механизм, с помощью которого STAT3 контролирует организацию хроматина. Действительно, мы наблюдали ситуацию in vitro , когда полноразмерные белки U-STAT3 объединяют отдаленные участки плазмидных ДНК подобно механизму образования петель ДНК, индуцируемому MAR-белками. У Drosophila фосфорилирование STAT92E запускает его диссоциацию от гетерохроматина и стимулирует связывание с его собственным ДНК-связывающим мотивом.В соответствии с находками Drosophila , мы предполагаем, что фосфорилирование STAT3 может запускать его диссоциацию от AT-богатых участков ДНК и стимулировать связывание с мотивом GAS. Это может привести к изменениям в петлеобразовании ДНК и реорганизации хроматина, которые происходят после активации пути JAK-STAT. Необходимы дальнейшие исследования для изучения этой гипотезы in vivo .

      Наконец, наши данные АСМ-изображения позволили нам идентифицировать укороченную С-концевую изоформу 67,5 кДа, присутствующую в ядерных экстрактах раковых клеток.Предыдущие сообщения показали, что ограниченный протеолитический процессинг сериновыми протеазами, кальций-зависимой цистеиновой протеазой кальпаин или каспазами продуцирует STAT-укороченные белки, обозначенные STATγs (45–48). Посттрансляционное усечение С-концевого домена и сайта фосфорилирования тирозина делает изоформы STATγ отличными от изоформ STAT3α структурно и функционально. Поскольку молекулы STATγ сохраняют ДНК-связывающий домен, они рассматриваются как доминантно-негативные регуляторы STAT-зависимой транскрипции (46, 48), которые могут иметь совершенно другие функции, чем полноразмерный STAT3α, который был основным объектом нашего исследования.Наши данные показывают, что изоформа 67,5 кДа связывается с областями одноцепочечной ДНК внутри крестообразной формы, образованной палиндромной последовательностью. Палиндромные последовательности, которые часто способны образовывать альтернативную структуру ДНК (крестообразную), участвуют в различных ДНК-опосредованных процессах, включая репликацию, транскрипцию и нестабильность генома (49). Палиндромы часто действуют как симметричные сайты узнавания для связывания регуляторных факторов, особенно димерных факторов транскрипции (40, 49-51).Сам элемент GAS представляет собой несовершенный палиндром (TTCNNNGAA), хотя и довольно короткий, обеспечивающий распознавание вторичной структуры STAT3, а также первичных последовательностей ДНК (52, 53). Таким образом, укороченная С-концевая изоформа 67,5 кДа может непосредственно регулировать транскрипцию генов посредством связывания с палиндромными последовательностями внутри промоторов генов. Более того, поскольку эта С-концевая укороченная изоформа не может подвергаться фосфорилированию, она может функционировать независимо от активации JAK и вмешиваться в функции полноразмерного STAT3.

      В заключение, исследования связывания ДНК с помощью U-STAT3 позволяют предположить, что U-STAT3 может участвовать в регуляции активности генов посредством связывания с AT-богатыми последовательностями ДНК, регуляции структуры хроматина и распознавания вторичных структур в дополнение к транскрипционным. активаторные функции. Экспрессия укороченной С-концевой изоформы и ее связывание с палиндромными структурами в ДНК может нарушать функции полноразмерного U-STAT3 и влиять на биологическую роль в раковых клетках.Более глубокое понимание этих дополнительных механизмов связывания ДНК STAT3 предлагает более широкий взгляд на потенциальные молекулярные мишени для специфических функций этих молекул.

      Благодарности

      Мы благодарим LCCC Proteomics и Tissue Cores за отличную помощь. Общие ресурсы Комплексного онкологического центра Ломбарди частично поддерживаются грантом Национального института здравоохранения CA56036-08 (Грант поддержки онкологического центра для Комплексного онкологического центра Ломбарди).

      * Эта работа полностью или частично поддержана грантом Национального института здравоохранения CA56036-08, грантом Американского онкологического общества IRG 97-152-17 (к О.T.) и программой внутренних исследований Национального института здравоохранения Центра исследований рака NCI.

      3 Используемые сокращения:

      GAS
      γ-активированная последовательность
      U-stat3
      Unphosphorylated stat3
      Unposphoryled stat3
      AFM
      атомная силовая микроскопия
      APS
      1- (3-аминопропил) Silatrane
      DAPA
      ДНК Анализы на аффициации DNA
      S/MAR
      Область прикрепления каркаса/матрицы.

      ССЫЛКИ

      1. Дарнелл Дж. Э., младший (1997) STAT и регуляция генов. Наука 277, 1630–1635 [PubMed] [Google Scholar]2. Бромберг Дж., Чен С. (2001) STAT-белки. Трансмиттеры сигналов и активаторы транскрипции. Методы Энзимол. 333, 138–151 [PubMed] [Google Scholar]3. Леви Д. Э., Дарнелл Дж. Э., младший (2002) Статистика, контроль транскрипции и биологическое воздействие. Нац. Преподобный Мол. Клеточная биол. 3, 651–662 [PubMed] [Google Scholar]4. Lim C.P., Cao X. (2006)Структура, функция и регуляция белков STAT.Мол. Биосист. 2, 536–550 [PubMed] [Google Scholar]6. Бромберг Дж. Ф., Вжещинска М. Х., Девган Г., Чжао Ю., Пестелл Р. Г., Альбанезе К., Дарнелл Дж. Э., мл. (1999) Stat3 как онкоген. Клетка 98, 295–303 [PubMed] [Google Scholar]7. Turkson J., Jove R. (2000) STAT-белки, новые молекулярные мишени для открытия лекарств от рака. Онкоген 19, 6613–6626 [PubMed] [Google Scholar]8. Ян Дж., Чаттерджи-Кишор М., Стаугайтис С.М., Нгуен Х., Шлессингер К., Леви Д.Е., Старк Г.Р. (2005) Новые роли нефосфорилированного STAT3 в онкогенезе и регуляции транскрипции.Рак рез. 65, 939–947 [PubMed] [Google Scholar]9. Yang J., Liao X., Agarwal M.K., Barnes L., Auron P.E., Stark G.R. (2007)Нефосфорилированный STAT3 накапливается в ответ на IL-6 и активирует транскрипцию путем связывания с NFκB. Гены Дев. 21, 1396–1408 [бесплатная статья PMC] [PubMed] [Google Scholar]10. Ян Дж., Старк Г.Р. (2008)Роль нефосфорилированных STAT в передаче сигналов. Сотовый рез. 18, 443–451 [PubMed] [Google Scholar]11. Райх Н.К., Лю Л. (2006) Отслеживание ядерного трафика STAT. Нац. Преподобный Иммунол.6, 602–612 [PubMed] [Google Scholar]12. Shi S., Calhoun HC, Xia F., Li J., Le L., Li WX (2006) Передача сигналов JAK глобально противодействует подавлению гетерохроматических генов. Нац. Жене. 38, 1071–1076 [бесплатная статья PMC] [PubMed] [Google Scholar]13. Shi S., Larson K., Guo D., Lim S.J., Dutta P., Yan S.J., Li W.X. (2008) Drosophila STAT необходим для непосредственного поддержания локализации HP1 и стабильности гетерохроматина. Нац. Клеточная биол. 10, 489–496 [бесплатная статья PMC] [PubMed] [Google Scholar]14.Часовских С., Димчев А., Смулсон М., Дритчило А. (2005) Переходы ДНК, индуцированные связыванием PARP-1 с крестообразными структурами в суперскрученных плазмидах. Цитометрия А 68, 21–27 [PubMed] [Google Scholar]15. Пьетрасанта Л.И., Троуэр Д., Хси В., Рао С., Стемманн О., Лехнер Дж., Карбон Дж., Хансма Х. (1999) Исследование центромерной ДНК Saccharomyces cerevisiae (ДНК CEN)-связывающего фактора 3 ( CBF3) кинетохорного комплекса с помощью атомно-силовой микроскопии. проц. Натл. акад. науч. США. 96, 3757–3762 [бесплатная статья PMC] [PubMed] [Google Scholar]16.Schneider S.W., Lärmer J., Henderson R.M., Oberleithner H. (1998) Молекулярные массы отдельных белков коррелируют с молекулярными объемами, измеренными с помощью атомно-силовой микроскопии. Арка Пфлюгера. 435, 362–367 [PubMed] [Google Scholar]17. Основная группа разработки R (2011 г.). R: Язык и среда для статистических вычислений, R Foundation for Statistical Computing, Вена, Австрия [Google Scholar]18. Тимофеева О. А., Плисов С., Евсеев А. А., Пенг С., Хосе-Кампфнер М., Ловворн Х. Н., Доум Дж. С., Перантони А.O. (2006) Фосфорилированный серином STAT1 является фактором выживания в патогенезе опухоли Вильмса. Онкоген 25, 7555–7564 [PubMed] [Google Scholar]19. Тимофеева О. А., Гапоненко В., Локетт С. Дж., Тарасов С. Г., Цзян С., Мишейда С. Дж., Перантони А. О., Тарасова Н. И. (2007) Рационально разработанные ингибиторы определяют N-домен STAT3 как перспективную мишень для противоопухолевых препаратов. АКС хим. биол. 2, 799–809 [PubMed] [Google Scholar]20. Yu Q., Thieu V.T., Kaplan M.H. (2007) Stat4 ограничивает привлечение ДНК-метилтрансферазы и метилирование ДНК гена IL-18Rα во время дифференцировки Th2.ЭМБО Дж. 26, 2052–2060 [бесплатная статья PMC] [PubMed] [Google Scholar]21. Джерабек-Виллемсен М., Винкен С.Дж., Браун Д., Бааске П., Дур С. (2011)Исследования молекулярного взаимодействия с использованием микромасштабного термофореза. Анализ наркотиков Dev. Технол. 9, 342–353 [бесплатная статья PMC] [PubMed] [Google Scholar]22. Винкен С. Дж., Бааске П., Ротбауэр У., Браун Д., Дур С. (2010)Анализ связывания белков в биологических жидкостях с использованием микромасштабного термофореза. Нац. коммун. 1, 100. [PubMed] [Google Scholar] 23. Цильнер К., Джерабек-Виллемсен М., Дур С., Браун Д., Ленгст Г., Бааске П. (2012)Микромасштабный термофорез как чувствительный метод количественного определения белка. Взаимодействие нуклеиновых кислот в растворе. Методы Мол. биол. 815, 241–252 [PubMed] [Google Scholar]24. Усачева Е.А., Шляхтенко Л.С., Гласс Р., Синден Р.Р., Любченко Ю.Л., Потаман В.Н. (1999) Структура разветвленных молекул ДНК. Замедление геля и исследования атомно-силовой микроскопии. Дж. Мол. биол. 292, 75–86 [PubMed] [Google Scholar]25. Лонская И., Потаман В. Н., Шляхтенко Л.С., Усачева Е.А., Любченко Ю.Л., Солдатенков В.А. (2005) Регуляция поли(АДФ-рибозо)полимеразы-1 путем специфичного связывания ДНК. Дж. Биол. хим. 280, 17076–17083 [PubMed] [Google Scholar]26. Либих И., Боде Дж., Фриш М., Вингендер Э. (2002) S/MARt DB, база данных об областях, прикрепленных к каркасу/матрице. Нуклеиновые Кислоты Res. 30, 372–374 [бесплатная статья PMC] [PubMed] [Google Scholar]27. Либих И., Боде Дж., Рейтер И., Вингендер Э. (2002) Оценка мотивов последовательности, обнаруженных в областях, прикрепленных к каркасу / матрице (S / MAR).Нуклеиновые Кислоты Res. 30, 3433–3442 [бесплатная статья PMC] [PubMed] [Google Scholar]29. Лобов И.Б., Цуцуи К., Митчелл А.Р., Подгорная О.И. (2001) Специфичность связывания SAF-A и ламина B in vitro коррелирует с состоянием изгиба сателлитной ДНК. J. Cell Biochem. 83, 218–229 [PubMed] [Google Scholar]30. Чаттерджи-Кишор М., Райт К.Л., Тинг Дж.П., Старк Г.Р. (2000) Как Stat1 опосредует конститутивную экспрессию генов. Комплекс нефосфорилированного Stat1 и IRF1 поддерживает транскрипцию гена LMP2 .ЭМБО Дж. 19, 4111–4122 [бесплатная статья PMC] [PubMed] [Google Scholar]31. Chen X., Vinkemeier U., Zhao Y., Jeruzalmi D., Darnell JE, Jr., Kuriyan J. (1998) Кристаллическая структура фосфорилированного тирозином димера STAT-1, связанного с ДНК. Клетка 93, 827–839 [PubMed] [Google Scholar]32. Vinkemeier U., Cohen S.L., Moarefi I., Chait B.T., Kuriyan J., Darnell JE, Jr. (1996) ДНК-связывание in vitro активировало Stat1α, Stat1β и усеченный Stat1. Взаимодействие между NH 2 -концевыми доменами стабилизирует связывание двух димеров с тандемными участками ДНК.ЭМБО Дж. 15, 5616–5626 [бесплатная статья PMC] [PubMed] [Google Scholar]33. Fordyce P.M., Gerber D., Tran D., Zheng J., Li H., DeRisi J.L., Quake S.R. (2010) De novo идентификация и биофизическая характеристика сайтов связывания факторов транскрипции с помощью микрожидкостного аффинного анализа. Нац. Биотехнолог. 28, 970–975 [бесплатная статья PMC] [PubMed] [Google Scholar]34. Yoo J.Y., Wang W., Desiderio S., Nathans D. (2001) Синергетическая активность STAT3 и c-Jun в отношении определенного набора элементов ДНК в промоторе α 2 -макроглобулина.Дж. Биол. хим. 276, 26421–26429 [PubMed] [Google Scholar]35. Moreau J., Marcaud L., Maschat F., Kejzlarova-Lepesant J., Lepesant J.A., Scherrer K. (1982) A+T-богатые линкеры определяют функциональные домены в эукариотической ДНК. Природа 295, 260–262 [PubMed] [Google Scholar]36. Oosumi T., Garlick B., Belknap W.R. (1995)Идентификация и характеристика предполагаемых мобильных элементов ДНК в пасленовых растениях и Caenorhabditis elegans . проц. Натл. акад. науч. США. 92, 8886–8890 [бесплатная статья PMC] [PubMed] [Google Scholar]37.Patikoglou G.A., Kim J.L., Sun L., Yang S.H., Kodadek T., Burley S.K. (1999) Распознавание элемента TATA белком, связывающим коробку TATA, сохранялось на протяжении всей эволюции. Гены Дев. 13, 3217–3230 [бесплатная статья PMC] [PubMed] [Google Scholar]38. Yasui D., Miyano M., Cai S., Varga-Weisz P., Kohwi-Shigematsu T. (2002) SATB1 нацелен на ремоделирование хроматина, чтобы регулировать гены на больших расстояниях. Природа 419, 641–645 [PubMed] [Google Scholar]39. Златанова Дж., ван Холде К. (1998) Связывание ДНК с четырехсторонним соединением.Общее свойство архитектурных белков? ФАСЭБ Дж. 12, 421–431 [PubMed] [Google Scholar]40. Бразда В., Лайстер Р. К., Ягельска Э., Эрроусмит К. (2011) Крестообразные структуры являются общей особенностью ДНК, важной для регуляции биологических процессов. БМК Мол. биол. 12, 33. [Бесплатная статья PMC] [PubMed] [Google Scholar]41. Лав Дж. Дж., Ли К., Кейс Д. А., Гизе К., Гроссшедл Р., Райт П. Е. (1995) Структурная основа изгиба ДНК с помощью архитектурного фактора транскрипции LEF-1. Природа 376, 791–795 [PubMed] [Google Scholar]43.Christova R., Jones T., Wu PJ, Bolzer A., ​​Costa-Pereira AP, Watling D., Kerr IM, Sheer D. (2007) P-STAT1 опосредует ремоделирование хроматина более высокого порядка MHC человека в ответ на IFNγ . Дж. Клеточные науки. 120, 3262–3270 [PubMed] [Google Scholar]44. Ши М., Лин Т. Х., Аппелл К. С., Берг Л. Дж. (2008) Зависимые от янус-киназы-3 сигналы индуцируют ремоделирование хроматина в локусе Ifng во время дифференцировки Т-хелперов 1. Иммунитет 28, 763–773 [бесплатная статья PMC] [PubMed] [Google Scholar]45. Хевехан Д.L., Miller WM, Papoutsakis ET (2002)Дифференциальная экспрессия и фосфорилирование различных белков STAT3 во время гранулоцитарной дифференцировки. Кровь 99, 1627–1637 [PubMed] [Google Scholar]46. Azam M., Lee C., Strehlow I., Schindler C. (1997) Функционально различные изоформы STAT5 генерируются путем процессинга белка. Иммунитет 6, 691–701 [PubMed] [Google Scholar]47. Ода А., Вакао Х., Фуджита Х. (2002) Кальпаин является преобразователем сигнала и активатором транскрипции (STAT) 3 и протеазы STAT5.Кровь 99, 1850–1852 [PubMed] [Google Scholar]48. Дарновски Дж. В., Гулетт Ф. А., Гуан Ю. Дж., Чаттерджи Д., Ян З. Ф., Кусенс Л. П., Чин Ю. Э. (2006) Расщепление Stat3 каспазами. Влияние на полноразмерную экспрессию Stat3, образование фрагментов и транскрипционную активность. Дж. Биол. хим. 281, 17707–17717 [PubMed] [Google Scholar]49. Хамфри-Диксон Э. Л., Шарп Р., Шукерс М., Лок Р. (2011) Сравнительный анализ генома позволяет предположить характеристики инвертированных повторов дрожжей, которые важны для транскрипционной активности.Геном 54, 934–942 [PubMed] [Google Scholar]50. LeBlanc J.F., McLane K.E., Parren P.W., Burton D.R., Ghazal P. (1998) Распознающие свойства ДНК-связывающего антитела, специфичного к последовательности. Биохимия 37, 6015–6022 [PubMed] [Google Scholar]51. Лу Л., Цзя Х., Дроге П., Ли Дж. (2007) Распределение палиндромов ДНК по всему геному человека. Функц. интегр. Геномика 7, 221–227 [PubMed] [Google Scholar]52. Эрет Г.Б., Райхенбах П., Шиндлер У., Хорват С.М., Фриц С., Набхольц М., Бухер П. (2001) Специфичность связывания ДНК различных белков STAT.Сравнение специфичности in vitro с естественными сайтами-мишенями. Дж. Биол. хим.

Добавить комментарий

Ваш адрес email не будет опубликован.